Humans and Chimps

FROGGIE
Similarities between human and chimp chromosomes: Evidence of a common
creator, or common descent?

I think we can all agree that humans and chimpanzees share some remarkable
similarities. Not only do we look alike at the macro and micro level, we
also have some behavioral similarities. Now, these similarities alone do
not prove the theory of evolution. They could simply be evidence of
a common creator.

Let's look at one particular piece of evidence in more detail. Before we
even knew what chromosomes were, scientists speculated that humans and
chimps descended from a common ancestor. After scientists started studying
DNA, the similarities were striking, and further supported this theory.
Here's a picture from the

evolution evidence page http://www.gate.net/~rwms/hum_ape_chrom.html
http://www.gate.net/~rwms/hum_ape_chrom_2.gif

Human Chromosome 2 and its analogs in the apes. H=human, C=chimp, G=gorilla,
O=orangutan.

The black lines are where the chromosomes have similar G-banding patterns.
Humans have 46 chromosomes (23 in sperm and eggs), and chimps have 48 (24 in
sperm and eggs). This may seem at first to be a problem for evolutionary
theory. Shouldn't we have the same chromosome number? Well, scientists
hypothesize that a chromosome fusion event occurred somewhere along the
evolutionary path, and this is why humans have one less chromosome in the
haploid genome. If you look at the picture again, you can see how the two
primate chromosomes do resemble the one human chromosome.
<BLOCKQUOTE>quote:</font><HR>From the evolution evidence page:
There are two potential naturalistic explanations for the difference in
chromosome numbers - either a fusion of two separate chromosomes occurred in
the human line, or a fission of a chromosome occurred among the apes. The
evidence favors a fusion event in the human line. One could imagine that
the fusion is only an apparent artifact of the work of a designer or the
work of nature (due to common ancestry). The common ancestry scenario
presents two predictions. Since the chromosomes were apparently joined
end to end, and the ends of chromosomes (called the telemeter ) have a
distinctive structure from the rest of the chromosome, there may be evidence
of this structure in the middle of human chromosome 2 where the fusion
apparently occurred. Also, since both of the chromosomes that hypothetically
were fused had a Centro mere (the distinctive central part of the
chromosome), we should see some evidence of two centromeres.<HR></BLOCKQUOTE>
So while both creationists and evolutionists could use the similar
chromosomes as evidence for their theory, only evolutionary theory makes
detailed predictions about specific things we would find in the chromosomes.
Do these predictions come true?
<BLOCKQUOTE>quote:</font><HR>From the evolution evidence page:
The first prediction (evidence of a telomere at the fusion point) is shown
to be true in reference 3 . Telomeres in humans have been shown to consist
of head to tail repeats of the bases 5'TTAGGG running toward the end of the
chromosome…When the vicinity of chromosome 2 where the fusion is expected to
occur…is examined, we see first sequences that are characteristic of the
pre-telomeric region, then a section of telomeric sequences, and then
another section of pre-telemetric sequences. Furthermore, in the telomeric
section, it is observed that there is a point where instead of being
arranged head to tail, the telomere repeats suddenly reverse direction…and
the second pre-telomeric section is also the reverse of the first telomeric
section. This pattern is precisely as predicted by a telomere to telomere
fusion of the chimpanzee (ancestor) 2p and 2q chromosomes, and in precisely
the expected location.
The second prediction - remnants of the 2p and 2q centromeres is documented
in reference 4. The normal centromere found on human chromosome 2 lines up
with the 2p chimp chromosome, and the remnants of the 2q chromosome is found
at the expected location based upon the banding pattern. <HR></BLOCKQUOTE>
The answer--yes, the predictions that evolutionary theory made did indeed
come true. I now ask any creationist to come up with a better explanation
as to why these specific similarities and differences occur in the
chromosomes? If humans and chimps were 'created separately,' why the
incredible coincidence of what looks like chromosome fusion? Why would a
creator put evidence of telomeres in the middle of the human chromomsome?
Why don't chimps have, say 32 chromosomes with their genes in a different
order?

Another question that you may have is how the fusion could have occurred,
and survived, since many chromosome anomalies are deadly or sterile.
<BLOCKQUOTE>quote:</font><HR>From the evolution evidence page:
Some may raise the objection that if the fusion was a naturalistic event,
how could the first human ancestor with the fusion have successfully
reproduced? We have all heard that the horse and the donkey produce an
infertile mule in crossing because of a different number of chromosomes in
the two species. Well, apparently there is more to the story than we are
usually told, because variations in chromosome number are known to occur in
many different animal species, and although they sometimes seem to lead to
reduced fertility, this is often not the case. Refs 5, 6, and 7 document
both the existence of such chromosomal number differences and the fact that
differences do not always result in reduced fertility. I can provide many
more similar references if required. The last remaining species of wild
horse, Przewalski's (sha-val-skis) Wild Horse has 66 chromosomes while the
domesticated horse has 64 chromosomes. Despite this difference in chromosome
number, Przewalski's Wild Horse and the domesticated horse can be crossed
and do produce fertile offspring. <HR></BLOCKQUOTE>
So this chromosome fusion event fits with the evolutionary model, the
chromosomes have over 99% similarity and in the right order, there is direct
evidence of fusion in the human chromosome, and it is feasible, since
animals with different chromosome numbers have produced viable offspring.
How does YEC account for all of these amazing "coincidences?"

froggie

[ January 23, 2002: Message edited by: Administrator ]

 

HELEN
Hi froggie,
This is a little harder responding this way! I have to copy your post onto an email or Word page to see it!

Oh well. You asked for specific responses to a specific thing. I can't do that. So I certainly won't pretend. And, thus, I won't take up much time with this response. But I would want to say that, considering the
evident evidence that we are genetically 99% the same as chimps, and then looking at them and looking at us, my only possible response is something along the lines of "well, genetics certainly doesn't tell the whole story then, does it?"

What might be interesting to note, though, is that Science for Jan. 4, 2002 has what appears to be an interesting article. I only have access to the abstract at this point, but the last sentence in this abstract
grabbed my attention. Here it is:

Construction and Analysis of a Human-Chimpanzee Comparative Clone Map
Asao Fujiyama,12* Hidemi Watanabe,1* Atsushi Toyoda,1* Todd D. Taylor,1* Takehiko Itoh,3* Shih-Feng Tsai,45* Hong-Seog Park,6* Marie-Laure Yaspo,7* Hans Lehrach,7 Zhu Chen,8* Gang Fu,8* Naruya Saitou,2* Kazutoyo
Osoegawa,9 Pieter J. de Jong,9 Yumiko Suto,10 Masahira Hattori,1* Yoshiyuki Sakaki111*

The recently released human genome sequences provide us with reference data
to conduct comparative genomic research on primates, which will be important
to understand what genetic information makes us human. Here we present a
first-generation human-chimpanzee comparative genome map and its initial
analysis. The map was constructed through paired alignment of 77,461 chimpanzee bacterial artificial chromosome end sequences with publicly available human genome sequences. We detected candidate positions, including two clusters on human chromosome 21 that suggest large, nonrandom
regions of difference between the two genomes.

So I guess my question is, do we really have enough evidence in to make a judgment about even the genetic similarity between man and chimp?

Helen

 

FROGGIE
Hello Helen, thank you for your reply.
Helen stated, “So I guess my question is, do we really have enough evidence
in to make a judgment about even the genetic similarity between man and
chimp?”

The first thing I thought about when answering this question was, well, me!
See, I used to be a tadpole. I had gills, and I had a tail instead of arms
and legs. Now I hop around on four legs, breathe through my lungs and my
skin, and my tail has disappeared. What is the difference between my
genomic DNA then, and now? Assuming no mutations, Zero. Gene
expression makes all the difference. So yes Helen, the answer to
your question-hypothetically-is “Yes.”

Let’s look at that paper further (which I happen to have right here).
First off, the author’s conclusions:
<BLOCKQUOTE>quote:</font><HR>We detected candidate positions, including two clusters on human
chromosome 21 that suggest large, nonrandom regions of difference between
the two genomes.<HR></BLOCKQUOTE>
Note the words “large difference” here. What did these scientists do?
Well, this is a pretty technical paper but I will try to outline it for
everyone. Keep in mind that most of the human genome is sequenced and in a
database. So, these scientists generated a library of chimpanzee genomic
sequences. This is done by cuttting up the chromosomes and sticking them
into expression vectors. This is done because you can’t sequence a
full-length chromosome in one sequencing reaction! Anyway, they took each
sequence and compared each one to the human genome database. In the paper
the pieces were called bacterial artificial chromosome end sequences or BECs
(the bacteria is the vector—we are still talking about chimp DNA ok!).

About the BECs: “Most BECs have higher identity, we also found the
existence of many lower-identity BECs in the genome.” They started with
114,421 pieces of chimp DNA. 77,461 of these pieces matched over 90% to a
human sequence. This leaves 36,960 pieces which don’t match.
1. 1168 of them were “repeat” sequences (repetitive DNA which we think has
no function).
2. 515 pieces matched a species other than human.
3. 20,376 matched human sequences in a different database.
This leaves 14,901 pieces which did not match to humans. There are several
possibilities for these sections:
A. Perhaps they match to a human region that hasn’t been sequence yet.
B. They belong to regions which have diverged substantially from humans
(and are true chimp-specific genes).
Their calculation of percent identity is 98.77% between human and chimp.
This number can vary depending on how you do the calculation, but is always
between 98 and 99%.

Then they looked at specific regions. In chromosome 10 (12 in humans) they
found something interesting. They found a sequence of genes that were
inverted in gorilla and chimp, as opposed to human and orangutan. “The
effect of the inversion on these genes should be the target of future
studies.”

On chromosome 21, they found 7 sites that were exclusive to humans,
“suggesting that these loci might correspond to insertions that are specific
to the human lineage.”

Helen asked, “evident evidence that we are genetically 99% the same as
chimps, and then looking at them and looking at us, my only possible
response is something along the lines of "well, genetics certainly doesn't
tell the whole story then, does it?"”

Indeed, Helen is correct. Like my tadpole to frog transition above,
obviously the raw DNA sequence is not enough to account for differences in
phenotypes. Gene expression is very important. Remember my note above
about the genes found in an inverted order? Well, this could be an
important regulatory feature of the genes. Also remember that many genes
are pleiotropic, meaning they have more than one function. This is another
way that only a 1 or 2% difference could cause major changes. Third, let’s
really look at 1%. I’ll use the most conservative difference here being one
percent. 1% of 3 x10e9 is still thirty million differences. Let’s assume
that only 3% of the genome even matters. Thats 0.03 x 0.01 x 3x10e9 which
is nine hundred thousand differences between humans and chimps. Did
evolution have enough time to get this many differences? If you consider
macrogenetic changes such as gene duplications and chromosome fusions in
addition to point mutations, absolutely. Is this many differences enough to
account for human and chimp differences? Anyone who understands gene
regulation will give you an emphatic “Yes indeed.”

I’m still waiting for the creationist explanation as to why we have evidence
of chimpanzee chromosome ends in the middle of our chromosomes.

froggie

 

DAVID PLAISTED
I think it's best not to become obsessed with the human-chimp relationship, though it has a lot of interest for us personally. This reminds me of a situation I had when writing an program and worked hard to optimize it for a particular set of inputs. Then it turned out not to work well for a wider range of inputs. We should look at the overall evolutionary scenario and see how it works instead. Even some creationists have proposed that apes are degenerated humans (I once heard) or maybe humans are degenerated apes or both degenerated from something else. Another thing to keep in mind is that all the mammals are similar genetically (even humans and mice) and when you add this to the morphological similarity between humans and apes it is not surprising that one can get a 98 percent similarity or whatever it is. Also there are epigenetic factors that can influence the expression of genes, that are not even part of the DNA, and this can account for more differences. A recent article in science mentioned surprisingly rapid evolution of finches in two regions of the USA, so one could get a lot of change in a short time. But I will be interested to see whatever the biologists can uncover about the relationship between humans and apes.

Dave Plaisted

 

[Administrator: RufusAtticus requested the entire abstract be available which Helen had referred to. The article itself cannot be accessed unless you subscribe to Science.]

RUFUSATTICUS

Fujiyama A et al. "Construction and analysis of a human-chimpanzee
comparative clone map." Science 2002 Jan 4;295(5552):131-4

Pubmed database entry: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&list_ui
ds=11778049&dopt=Abstract

[ January 28, 2002: Message edited by: Administrator ]

 

SCOTT PAGE

[response to Plaisted:]
I am always a bit perplexed when I see such sentiments. To the best of my knowledge, no genes controlling or directly influencing morphology have been discovered, much less sequenced and compared with those of other species. The genes and non-genic regions that have been analyzed deal largely with physiology (if anything). What is the logic employed to conclude that because humans and chimps have a similar outward morphology, we should expect genes involved in encoding proteins involved in doing things like carrying oxygen or playing a role in blood clotting to show the same hierarchical patterns hypothesized under evolutionary assumptions?

 

FROGGIE
Thanks for everyone's replies.
David Plaisted had commented, "I think it's best not to become obsessed with
the human-chimp relationship, though it has a lot of interest for us
personally. "

I am choosing to focus mainly on human-chimp evolution for this forum,
mainly because in my experience with debating creationists at infidels, it's
the only relationship that matters to their faith. If fish evolved
from frogs, no matter. It's the "humans evolved from apes" bit that seems
to be the main objection for a majority of creationists.

Furthermore for me as a future doctor, human medicine in the context of
evolution is an important concept. Baptists on this forum may think my
motivations here are to irritate them but this is not entirely the
case . I honestly believe that studying how humans evolved will give us
unique insights into our human-ness (our violent tendencies, addictive
behaviors, and how we get diseases are some examples). Thus, creationists
are in a way stagnating human understanding and progress.


DP: This reminds me of a situation I had when writing an program and worked
hard to optimize it for a particular set of inputs. Then it turned out not
to work well for a wider range of inputs. We should look at the overall
evolutionary scenario and see how it works instead.

This has been done. There is a plethora of evidence which supports
evolutionary theory, from bacteria to mammals.


DP: Another thing to keep in mind is that all the mammals are similar
genetically (even humans and mice) and when you add this to the
morphological similarity between humans and apes it is not surprising that
one can get a 98 percent similarity or whatever it is.

Ok, I see your point. Our genetics and our morphology are of course
related, so animals similar in morphology would be expected to have similar
genetics (whether due to common creator or evolution).

Until you realize that much of the genetic data is not necessarily related
to morphology. Go back up and click on the human and chimp chromosome image
again. Why are the G-banding patterns so consistent? Much of these G-bands
are in our non-coding, or "junk" parts. Why is the junk so similar? I
think YEC would not predict this observation.

And why such a similar number of chromosomes, consistent with a chromosome
fusion event? Chromosome number, as well as DNA content per cell, does not
correlate with morphology or complexity, so Dave's argument doesn't really
hold when you look at "the overall evolutionary scenario."

Also, think about gene duplication. This occurs when chromosomes line up
during meiosis, and unequally cross over. Thus, one sperm or egg gets two
copies of a gene (the other sperm or egg gets none, and most likely dies).
Many genes have duplicated and diverged in this manner, and their
duplication can be traced along evolutionary trees. For example, in an
early lineage, you will find one gene. Then in a later lineage, you will
find two copies in tandem. Then still later, four in a row (two times two).
Ok, you could still claim "common creator" but evolution gives such a
great explanation-it explains the mechanism as well as the
similarities.


DP: recent article in science mentioned surprisingly rapid evolution of
finches in two regions of the USA, so one could get a lot of change in a
short time.

Volume and page number please? I believe I read the article you are
refering to. Usually rapid means
100,000 years instead of 1,000,000, not 6000 years instead of 1,000,000.

I’m still waiting for the creationist explanation as to why we have evidence
of chimpanzee chromosome ends in the middle of our chromosomes.

froggie

 

DAVID PLAISTED
I am perplexed and astonished at the statement that morphology has little
to do with genetics, as if the overall form of an organism is somehow
pasted on with little relation to its biology. The organism is a unit
and one would expect similar morphology to correlate with similar
genetics.
David Plaisted

 

DAVID PLAISTED
Froggie mentions that the G banding patterns are similar in humans and
chimps. Again, I think this is an evidence of a fixation on this one
issue. What we need is to look at G banding patterns of many
organisms, many mammals and maybe some non-mammals too. Then we can
evaluate the significance of the commonalities between humans and
apes. Froggie mentions that this common pattern even occurs in junk
regions. We still don't know much about the junk DNA but it could
have a function. I saw a web page that asserted the DNA (each strand)
tends to be complementary to _itself_ over certain short distances and
this pattern is often consistent and preserved when other things
change. It's as if the DNA forms little U's all along itself at some
point. Anyway, for the junk DNA as well it would help to know more
about the patterns in a wider variety of organisms.
Dave Plaisted

 

FROGGIE
Hello again,
I have a small request of anyone replying to me here. Could you please
indicate to me your background in genetics? This is for your benefit--I
don't want to talk down to you or over your head, and knowing your
background would help tremendously! For the record, I have a bachelor's in
molecular and cellular biology, and a (nearly completed) master's degree in
cell biology and immunology, with several graduate courses dedicated to
genetics and gene expression.

David Plaisted commented, "I am perplexed and astonished at the statement
that morphology has little to do with genetics, as if the overall form of an
organism is somehow pasted on with little relation to its biology."

David, what I said was, "Until you realize that much of the genetic data is
not necessarily related to morphology."

The genetic data I am speaking of is not the actual genes and the proteins
they code for. I am speaking of the patterns of the genes on the
chromosomes.

What you are talking about, I think, is this: If the genetic code makes us
who we are, than a genetic code which makes a heart in a dog will be very
similar to the code that makes our heart. Is this what you mean? If so, I
agree. Similarity of the genes alone does not prove evolution--it could
still be evidence of a common designer.

But this is not the evidence I am talking about. Here is another quote from
the evolution evidence page (linked to in my first post above):
<BLOCKQUOTE>quote:</font><HR>When one looks at the chromosomes of humans and the living great apes
(orangutan, gorilla, and chimpanzee), it is immediately apparent that there
is a great deal of similarity between the number and overall appearance of
the chromosomes across the four different species...Furthermore, these
diagrams show the similarity of the chromosomes in that every one of 1,000
nonheterochromatic G-bands has been accounted for in the four species. That
means that each non-heterochromatic band has been located in each species.

The following observations can be made about similarities and differences
among the four species. Except for differences in non genetic
heterochromatin, chromosomes 6, 13, 19, 21, 22, and X have identical banding
patterns in all four species. Chromosomes 3, 11, 14, 15, 18, 20, and Y look
the same in three of the four species (those three being gorilla, chimps,
and humans), and chromosomes 1, 2p, 2q, 5, 7 - 10, 12, and 16 are alike in
two species. Chromosomes 4 and 17 are different among all 4 species.

Note how all of the bands between the two chromosomes will line up
perfectly if you flip the middle piece of either of the two chromosomes
between the p14.I and q14.I marks. The similarity of the marks will
include a match for position, number, and intensity (depth of staining).
Similar rearrangements to this can explain all of the approximately 1000
non-heterochromatic bands observed among each of the four species for these
three properties (band position, number, and intensity). <HR></BLOCKQUOTE>

These "genetic similarities" have nothing to do with the actual protein
products. They are simply stretches of G's in the sequence. Even if they
do have a function, this still does not explain why we primates all have the
same pattern of G bands. Our genes are not in any particular order that we
can ascertain. For example, I study an enzyme called NADPH oxidase, which
helps neutrophils fight off bacteria. It is a multi-protein complex. The
genes for each protein are found on completely different chromosomes, so
obviously their order and placement on our chromosomes do not affect their
function (i.e. they don't need to be together to work, and usually they are
not coded together). So, if chimps were created separately from humans, why
do they have not only the same genes, but also the same orders of genes,
when it is pretty clear that the order and placement of genes does not
really matter much?

Let's try a little experiment. Let's say I I wanted to recreate your post on
a word document but with ee cummings rules (no caps nor punctuation), I
could do one of two things.

1) I could create it separately by typing everything that I see but adding
changes along the way. You would expect to see similarities of course,
because I am trying to copy your post. You would perhaps expect to see some
errors too.
2) I could use the quote function on UBB. In this case, I would want to
delete all UBB codes as well as the ee cummings stuff. If I messed up and
left a part of UBB in, then there in the text, for everyone to see, would be
evidence that I used the quote function.

Here is the result of method #1 (common designer analogy):

david plaisted
i am perplexed and astonished at the staemnt that morphology has little to
do with genetics as if the overall form of an organism is somehow psated on
with little relation to its biology the organism is a unit and one would
expect similar morphology to correlate with similar genetcs
david plaisted

Here's a pretend recreation of #2 (evolution method):

david plaisted
I am perplexed and astonished at the statement that morphology has little to
do with genetics as if the overall form of an organism is somehow pasted on
with little relation to its biology the organism is a unit and one would
expect similar morphology to correlate with similar
genetics
david plaisted [/quote]

There, in my post is evidence not only that I copied your post but also an
explanation as to how I copied it. Now, how likely is it that I
accidentally type out the /quote thing if I am coping what I see on the
screen? Not very, because UBB code is not visible to me.

The leftover quote function is analogous to the chimp telomere sequence in
the middle of the human chromosome. This genetic marker indicates that
chimps and humans diverged from a common ancestor, and it also offers one
piece of evidence how this divergence occured. Gene duplications,
such as the various forms of hemoglobin, are also evidence of not only
common descent but also how the evolution occured. You will find for
example this sequence in the most 'primitive' species (I bolded the
theoretical gene):

AATCAGATGACTATGCTAGCTAGC

Then this part of the DNA became duplicated, giving the new organism two
genes to evolve instead of one.
AATCAGATGACTATGCTAGCTAGCAATCAGATGACTATGCTAGCTAGC

Then this region in the DNA gets duplicated again (probably more than just
this region, but anyway), and you will find this sequence in a more recently
evolved organism:

AATCAGATGACTATGCTAGCTAGCAATCAGATGACTATGCTAGCTAGCAATCAGATGACTATGCTAGCTAGCAATCAGATGACTATGCTAGCTAGC

Now there are four copies of the gene.

There, in the sequence, is evidence of gene duplication staring you in the
face. (Note here: this is what happened in many gene lineages--I will link
to the actual science later when I am confident this concept is being
understood. If you want to know how gene duplications happen, I made a
little drawing in my formal debate with Douglas J Bender called
"Macroevolution" something or other in the "Formal Debates and Discussions"
at infidels.org (can't link to it here). Scroll down until you see pictures
of chromosomes that I made on Paint.)


froggie

 

SCOTT PAGE

<BLOCKQUOTE>quote:</font><HR>I am perplexed and astonished at the statement that morphology has little to do with genetics, as if the overall form of an organism is somehow pasted on with little relation to its biology. The organism is a unit and one would expect similar morphology to correlate with similar genetics.
David Plaisted<HR></BLOCKQUOTE>

You misrepresent my position. I did not say that morphology is independent of genetics. What I plainly explained is that at this time, NOT A SINGLE GENE controlling or influencing morphology has been sequenced and compared to other species. I further explained that the genes that have been sequenced and compared are involved in physiological aspects such as oxygen transport or the visual cascade. That is not morphology. Certainly , we should expect the genes that control/influence morphology in apes and humans to be similar. But there is no logic behind the notion that, were we all separate creations, we should expect such genes as hemoglobin to exhibit the patterns that we observe.

Perhaps you can explain, David, why we should expect genes that have no (known) influence on morphology and non-genic, non-regulatory sequences to correlate with morphology.

Please provide citations as well.

Thanks,

Scott Page

[Administrator: citations are not requested or required by the Baptist Board, as this is a place for exchanging viewpoints and exposing those watching to the different arguments used by each side.]

 

DAVID PLAISTED
Thanks, Froggie, for the good post. Again this is a case of over
emphasis on one problem, the human-ape relationship. We should also
look at the sequences of genes for monkeys and other mammals, cats and
mice and horses etc. to see what the general trends are. There may
be reasons that the genes have a particular sequence on the
chromosome, having to do with how or when they are expressed.

Scott, even basic biology will be influenced by the bodily form
because it influences all aspects of an organism. I think what we have
here is a view of biology that attempts to make the correlation between
morphology and genetics an evidence for evolution, when in reality
it is not.

Dave Plaisted

 

SCOTT PAGE
<BLOCKQUOTE>quote:</font><HR>Scott, even basic biology will be influenced by the bodily form
because it influences all aspects of an organism. I think what we have
here is a view of biology that attempts to make the correlation between
morphology and genetics an evidence for evolution, when in reality
it is not.
<HR></BLOCKQUOTE>

Interesting. I was unaware that oxygen carrying molecules would be influenced by ‘bodily form.’ I teach biology at the college level, and did research in molecular phylogenetics for my doctorate, and I have never heard any such thing before.

What I find especially odd is that your last sentence is in fact nearly the opposite of what I have been writing. Unless, of course, you were referring to your own position?

Scott Page

 

FROGGIE
David stated: Thanks, Froggie, for the good post.

You are welcome. It was fun to write, actually.

David: There may be reasons that the genes have a particular sequence on
the chromosome, having to do with how or when they are expressed.[...]I
think what we have here is a view of biology that attempts to make the
correlation between morphology and genetics an evidence for evolution, when
in reality it is not.

You are saying a couple of things here. First I will address the sequence
similarity issue. You are correct in stating that a position of genes can
be important. If you move a gene away from its promotor, it cannot get
switched on. However, there seems to be no good reason (other than the
evolutionary explanation) why the genes are oriented in such a bizarre way
in the first place. Perhaps there is one that hasn't been discovered yet.

When we compare among species the patterns, sequences, and orientations of
all these crazy things like pseudogenes, they correlate very well with the
phylogenetic trees that biologists drew before they even had genetic data!
Until scientists come up with a better biological reason as to why our
pseudogenes (and retroviruses, and G bands, etc) are all placed
strategically in an order just like our alleged ancestors, I will stick with
the evolutionary explanation.

My colleague (Oolon from infidels, a fellow scientist) recently gave this
great example:
<BLOCKQUOTE>quote:</font><HR>If life evolves by descent with modification, by copying genetic
material down generations, then we would expect that copying errors in
non-functioning DNA would only be present in some groups. While there may be
some reason why functioning DNA is similar in similar groups, there is no
reason why there should be homologies in DNA that does nothing, unless it
comes from a common ancestor. For instance, pseudogene equivalents are genes
which are identifiable as some functional gene in another organism, but
which have a mutation which has rendered them non-functional. There are
three sets of genes found in many species that have pseudogene equivalents
in primates, including humans, but not in other mammals: several odorant
receptor genes; the RT6 protein gene; and the galatosyl transferase gene.
The mutations which made these genes inoperable are shared among the
primates. There are numerous mutations that can render a gene
non-functional. Yet not only do primates have pseudogene versions of these
genes that are functional in other creatures, but these pseudogenes have
been made nonfunctional by the same mutations – they have the exact same
errors in the genes. This makes perfect sense if this genetic material was
inherited from a common ancestor.<HR></BLOCKQUOTE>

So, I guess the burden of proof is on the creationists now. Evolution has a
satisfactory explanation as to why our 'useless' DNA is there, and why it is
in a certain place. If this DNA serves a function both in its sequence and
in its location, let's see the data.

On to the morphology arguments:

How our genes dictate our morphology is an interesting and fascinating
puzzle for scientists. Indeed, one of my favorite biology classes as an
undergraduate was embryology. How do our cells 'know' to become vastly
different types of cells, such as muscle and nerve cells, when they all have
the same exact DNA? Gene expression is the key.

I disagree with you that the correlation between morphology and gene
expression does not provide evidence of evolution. Descent with
modification assumes that organisms come into existence by modifying
previous structures. This assumption would make the following predictions:

1) We would expect similar mechanisms for development, coded by similar DNA,
when you compare species.

Anyone that has taken embryology has learned that nature uses similar
patterns over and over to grow organisms from a single cell. Drosophila has
a set of genes called the homeobox genes, which regulate development using
nifty gradient tricks. We have four copies of these genes, called the HOX
genes, which play a similar role in human development. When you look at our
immune system genes, it appears that mammals 'borrowed' the drosophila
signal transduction system and simply modified it.

2) We would expect to remnants of 'instructions' for our ancestors body
plans in our DNA.

Do we find these remnants? Check out this web site on hen's teeth:
http://www.devbio.com/chap06/link0601.shtml

<BLOCKQUOTE>quote:</font><HR>In 1980, Kollar and Fisher performed a simple experiment with
remarkable results. They took presumptive jaw epithelium...of 5-day chick
embryos, and they combined this epithelium with the molar mesenchyme of
16-day to 18-day mouse embryos. These tissues were allowed to adhere to each
other, and the mouse molar mesenchyme/chick jaw epithelium recombinants were
then cultivated within the anterior chamber of a mouse eye. Several of these
aggregates resulted in the formation of a particularly interesting
structure--a hen's tooth. These teeth were not like that of mammals.
Thus, the cells of the chick pharyngeal arches, which have not made teeth
for nearly 100 million years, still appear to have retained the genetic
potential to respond to an appropriate inducer. <HR></BLOCKQUOTE>
Before these studies, scientists hypothesized that modern birds evolved from
predecessor birds that had teeth (fossils had been found of prehistoric
birds with teeth). These teeth are distinct from mammalian teeth. So, now
these scientists show that indeed, the DNA coding for these ancient teeth is
still present in these birds. At some point along evolution, these teeth
lost their usefulness, but the DNA was still there.

There are other examples too. Here's a brilliant summary of this concept
provided by a colleague (Oolon from infidels):
<BLOCKQUOTE>quote:</font><HR>If life evolves by adaptation of pre-existing genetic recipes... we
would expect there to be signs of this: genetics tells us that phenotypic
effects are the result of genes being switched on or off during the making
of a body (plus environment of course), so a feature being lost does not
automatically mean that the DNA has been lost too – the genes may just be
inactive. Evolution thus predicts not only genetic homologies...but also
that sometimes there would be tell-tale ‘errors’, when normally unused old
genes become expressed. No surprise to an evolutionist, then, that horses
with three-toed feet are occasionally born, as are, more rarely, whales with
hind limbs. Most living insects have two pairs of wings; flies (Diptera),
which normally have a single pair, sometimes grow a second pair of wings
instead of halteres (balancing organs). As at 1985, twenty-three cases of
humans born with tails had been documented in the literature, and many more
of congenital hypertrichosis (babies covered all over in thick hair). Need I
mention that having a tail is typical of vertebrates, and being covered in
hair is a distinguishing feature, the default, of mammals? And there’s more.
Surgical manipulation of a chicken's foetus(sic) can induce structures to
grow that normally would not. Experiments have shown that chick embryonic
jaw tissue can be persuaded to grow teeth in the right conditions, though no
modern bird possesses teeth (but fossil ones do). The genetic instructions
for their growth are present, even though they are not usually expressed.
Furthermore, the growth of some structures induces the growth of others. The
fibula in modern birds is normally just an (atrophied) splinter, and the
tarsals are fused. Both reptiles and Archaeopteryx have full tibia and
fibula and lots of separate tarsals. By simply inserting a piece of mica
between the developing tibia and fibula of a chick embryo, Armand Hampé
produced an archaeopteryx-like leg, with not only a fibula fully to the
ankle, but separate tarsals.<HR></BLOCKQUOTE>

So, if you do as David suggested and "look at the sequences of genes for
monkeys and other mammals, cats and mice and horses etc. to see what the
general trends are," it is obvious to me that the evoutionary explanation is
the winner. Not only does it explain kooky things like human tails, hen's
teeth, and pseudogenes, it also predicts them.

froggie

 

DAVID PLAISTED
Froggie (who used to be a tadpole) says that there are similarities
in junk DNA and pseudogenes that correlate with evolutionary phlylogenies
known before the DNA was analyzed. I assume that there has been
some kind of systematic study with lots of data that shows such a
correlation? These phylogenies themselves are subject to modification.
It also depends how far back the phylogenies go. Creationists allow
a certain amount of evolution and so the observed correlations could
give a clue as to which organisms came from a common ancestor.

Along this line, chickens may have had teeth at one time. Degeneration
does not contradict creationist views.

However, I am uncertain what it means when Oolon says that a variety
of pseudogenes exist in many primates, but are active in other
mammals, and the inactivating mutations are identical in all these
primates. A typical gene has 1000 base pairs of coding DNA and
the chimp-human difference is one or two percent (say two) and for
other apes it is larger. This would give 20 differences in this
gene, 10 mutations per lineage, and more for other apes. So the
pseudogenes cannot be identical, right? So among these 20 differences,
do we know which one inactivated the gene? Or is it just assumed that
the one that they have in common did it?

Another thing is that if the genes were inactivated before the
assumed split then there should be some mutations even before the
split, and some of these might insert stop codons or whatever and also
inactivate the gene again.

Also, it is logical that primates, with their agility and intelligence,
may not need some genes (like the one for Vitamin C). In this case
it is an advantage to deactivate the gene because the organism need not
expend energy making the protein. Thus when such a mutation occurs it
can spread to the whole population. Now, of all mutations, the great
majority will not deactivate the gene. Thus there are not many
mutations altogether that will, probably frame shifts and some others.
Among these, some may be much more likely to occur than others, and
this pattern may be common to all the primates, so it is possible that
the same mutation could spread in all the populations.

Instead of just looking for cases where the primates have similarities
we have to be careful to look at all pseudogenes and see if there is a
pattern.

There are also many dramatic cultural differences that set man apart
from all the other primates. These must have some biological basis,
even if we haven't discovered it yet.

David Plaisted

 

FROGGIE

Hello again,
David stated, "Froggie (who used to be a tadpole) says that there are
similarities in junk DNA and pseudogenes that correlate with evolutionary
phlylogenies known before the DNA was analyzed. I assume that there has been
some kind of systematic study with lots of data that shows such a
correlation?"

Yes, there have been many studies.
http://talkorigins.org/faqs/comdesc/section4.html

Talkorigins, in
the article "29 Evidences for Macroevolution," is a good place to start.

<BLOCKQUOTE>quote:</font><HR>Both functional and nonfunctional genetic characters are routinely
compared. Studies of functional elements include ribosomal RNA, ubiquitous
proteins, and mitochondrial DNA comparisons; studies of nonfunctional
elements include comparisons of pseudogenes, endogenous retroviral genes,
and mobile genetic elements (such as introns, transposons, or
retroelements)<HR></BLOCKQUOTE>

The author then talks about a protein called cytochrome C--which is present
in all organisms from yeast to mammals. This protein is rather interesting.
It differs about 40% between humans and yeast. But the differences do not
seem to alter the function of the protein!

<BLOCKQUOTE>quote:</font><HR>It has been shown that the human cytochrome c protein works just fine
in yeast (a unicellular organism) that lacks its own native cytochrome c
gene, even though yeast cytochrome c differs from human cytochrome c over
40% of the protein...In fact, the cytochrome c genes from tuna, pigeon,
horse, Drosophila fly, and rat all function well in yeast that lack their
own native yeast cytochrome c...Furthermore, extensive genetic analysis of
cytochrome c has demonstrated that the majority of the protein sequence is
unnecessary for its function in vivo. Only about a third of the 100 amino
acids in cytochrome c are necessary to specify its function.<HR></BLOCKQUOTE>

What these studies imply is that most differences we see in mammalian and
yeast cytochrome C are not necessary for function.

Note I said "most differences." There are different versions of cytochrome
C which are slightly better at electron transport. But do these variations
in cyt C correlate with an intelligent design theory, or evolution?

<BLOCKQUOTE>quote:</font><HR>Nonetheless, for the sake of argument, let us assume that a
cytochrome c that transports electrons faster is required in organisms with
active metabolisms or with high rates of muscle contraction. If this were
true, we might expect to observe a pattern of sequence similarity that
correlates with similarity of environment or with physiological requirement.
However, this is not observed. For example, bat cytochrome c is much more
similar to human cytochrome c than to hummingbird cytochrome c; porpoise
cytochrome c is much more similar to human cytochrome c than to shark
cytochrome c. As stated earlier in prediction 3, the phylogenetic tree
constructed from the cytochrome c data exactly recapitulates the
relationships of major taxa as determined by the completely independent
morphological data (McLaughlin and Dayhoff 1973). These facts only
further support the idea that cytochrome c sequences are independent of
phenotypic function (other than the obvious requirement for a functional
cytochrome c that transports electrons).<HR></BLOCKQUOTE>

The author's conclusions for cytochrome c:
<BLOCKQUOTE>quote:</font><HR>The evidence given above demonstrates that for many ubiquitous
functional proteins (such as cytochrome c), there is an enormous number of
equivalent sequences which could form that protein in any given organism.
Whenever we find that two organisms have the same or very similar sequences
for a ubiquitous protein, we know that something fishy is going on. Why
would these two organisms have such similar ubiquitous proteins when the
odds are astronomically against it? We know of only one reason for why
two organisms would have two similar protein sequences in the absence of
functional necessity: heredity. Thus, in such cases we can confidently
deduce that the two organisms are genealogically related. In this sense,
sequence similarity is not only a test of the theory of common descent;
common descent is also a deduction from the principle of heredity and the
observation of sequence similarity. Finally, the similarity observed for
cytochrome c is not confined to this single ubiquitous protein; all
ubiquitous proteins that have been compared between chimpanzees and humans
are highly similar, and there have been many comparisons.<HR></BLOCKQUOTE>

Moving along to the "junk DNA" examples:

<BLOCKQUOTE>quote:</font><HR>Transposons are very similar to viruses. However, they lack genes for
viral coat proteins, cannot cross cellular boundaries, and thus they
replicate only in the genome of their host. They can be thought of as
intragenomic parasites. Except in the rarest of circumstances, the only mode
of transmission from one metazoan organism to another is directly by DNA
duplication and inheritance (e.g. your transposons are given to your
children) (Li 1997, pp. 338-345).

Finding the same transposon in the same chromosomal location in two
different species is strong direct evidence of common ancestry, since they
insert randomly and generally cannot be transmitted except by inheritance.
In addition, once a common ancestor has been postulated that contains this
transposition, all the descendants of this common ancestor should also
contain the same transposition. A possible exception is if this
transposition were removed due to a rare deletion event; however, deletions
are never clean and usually part of the transposon sequence remains.

Confirmation:
A common class of transposon is the SINE retroelement (Li 1997, pp.
349-352). One important SINE transposon is the 300 bp Alu element. All
mammals contain many Alu elements, including humans where they constitute
10% of the human genome (i.e. 60 million bases of functionless DNA) (Smit
1996; Li 1997, pp. 354, 357). Very recent human Alu transpositions have been
used to elucidate historic and prehistoric human migrations, since some
individuals have newer Alu insertions that other individuals lack. Most
importantly, in the human á-globin cluster there are seven Alu elements, and
each one is shared with chimpanzees in the exact same seven locations
(Sawada, Willard et al. 1985).

More specifically, three different specific SINE transpositions have been
found in the same chromosomal locations of cetaceans (whales), hippos, and
ruminants, all of which are closely related according to the standard
phylogenetic tree. However, all other mammals, including camels and pigs,
lack these three specific transpositions (Shimamura 1997).<HR></BLOCKQUOTE>

Here is another example, using pseudogenes:
<BLOCKQUOTE>quote:</font><HR>Other nonfunctional molecular examples that provide evidence of
common ancestry are pseudogenes. Pseudogenes are very closely related to
their functional counterparts (in primary sequence and often in chromosomal
location), except that either they have faulty regulatory sequences or they
have internal stops that keep the protein from being made. They are
functionless and do not affect an organism's phenotype when deleted.
Pseudogenes, if they are not vestigial (like the examples in prediction 7),
are created by gene duplication and subsequent mutation. There are many
observed processes that duplicate genes, including transposition events,
chromosomal duplication, and unequal crossing over of chromosomes. Like
transpositions (c.f. prediction 19), gene duplication is a rare and random
event and, of course, any duplicated DNA is inherited. Thus, finding the
same pseudogene in the same chromosomal location in two species is strong
evidence of common ancestry.

There are very many examples of shared pseudogenes between primates and
humans. One is the øç-globin gene, a hemoglobin pseudogene. It is shared
among the primates only, in the exact chromosomal location, with the same
mutations that render it nonfunctional (Goodman, Koop et al. 1989). Another
example is the steroid 21-hydroxylase gene. Humans have two copies of the
steroid 21-hydroxylase gene, a functional one and a nonfunctional
pseudogene. Inactivation of the functional gene leads to congenital adrenal
hyperplasia (CAH), a rare and serious genetic disease. Chimps and humans
both share the same eight bp deletion in this pseudogene that renders it
nonfunctional (Kawaguchi, O'hUigin et al. 1992). Note that in this case, the
nonfunctionality of the pseudogene has been positively demonstrated.<HR></BLOCKQUOTE>

This site contains even more evidence, but this post is already too long.
Is there abundant evidence, from functional and non-functional DNA
sequences, that support not only human-chimp evolution, but also the entire
evolutionary tree? Yes, definitely.

David stated, "Creationists allow
a certain amount of evolution and so the observed correlations could
give a clue as to which organisms came from a common ancestor. Along this
line, chickens may have had teeth at one time. Degeneration
does not contradict creationist views."

So what is the conflict between creation and evolution then? If you agree
that studying the evidence can "give a clue as to which organisms came from
a common ancestor" than aren't we in agreement? Exactly how much evolution
will creationists allow for, and how can you scientifically quantify
this amount?

<BLOCKQUOTE>quote:</font><HR>However, I am uncertain what it means when Oolon says that a variety
of pseudogenes exist in many primates, but are active in other
mammals, and the inactivating mutations are identical in all these
primates. A typical gene has 1000 base pairs of coding DNA and
the chimp-human difference is one or two percent (say two) and for
other apes it is larger. This would give 20 differences in this
gene, 10 mutations per lineage, and more for other apes. So the
pseudogenes cannot be identical, right? So among these 20 differences,
do we know which one inactivated the gene? Or is it just assumed that
the one that they have in common did it? <HR></BLOCKQUOTE>

I'm not exactly sure what you are asking here. Keep in mind that the
differences are an average. It's not that every single gene differs
by 20 base pairs! If there was more than one difference, you would not know
which one inactivated the gene first. But you should expect to see more
divergence between pseudogenes of lesser-related animals than more-related
animals (since they are not under selective pressure anymore). Read up on
pseudogenes from that site and see if that answers your question.

David stated, "Another thing is that if the genes were inactivated before
the assumed split then there should be some mutations even before the split,
and some of these might insert stop codons or whatever and also inactivate
the gene again."

You can't inactivate the gene again. Once it's inactivated, it's
inactivated (except for viruses, whose mutation and replication rates are so
high that you often get revertence). But yes, you would expect to see more
and more changes occuring, since there is nothing selecting against the
pseudogene mutations.

<BLOCKQUOTE>quote:</font><HR>Also, it is logical that primates, with their agility and
intelligence, may not need some genes (like the one for Vitamin C). In this
case it is an advantage to deactivate the gene because the organism need not
expend energy making the protein. Thus when such a mutation occurs it can
spread to the whole population. Now, of all mutations, the great majority
will not deactivate the gene. Thus there are not many mutations altogether
that will, probably frame shifts and some others. Among these, some may be
much more likely to occur than others, and this pattern may be common to all
the primates, so it is possible that the same mutation could spread in all
the populations. <HR></BLOCKQUOTE>

Are you saying here that the mutations are similar because they occur more
frequently, and not because they are inherited? This is very unlikely,
David--because they would have to occur in every single sperm and egg that
led to a new chimp. Heredity of the mutations is a much better explanation.

But the first part of this quote is exactly the process of evolution! You
got it! Except--the mutation did not happen because of the 'agile
primates,' it happened randomly. It survived non-randomly because it
conferred a fitness advantage. I also disagree with your assessment that "a
great majority will not deactivate the gene." Most mutations do de-activate
genes (except for gene duplications, which are a great source of evolution).

<BLOCKQUOTE>quote:</font><HR>There are also many dramatic cultural differences that set man apart
from all the other primates. These must have some biological basis, even if
we haven't discovered it yet.<HR></BLOCKQUOTE>

Absolutely. This is why I want people to accept evolution, because I
believe that understanding these differences will help us understand
ourselves.

froggie

 

FROGGIE
Here's a site that I thought might be helpful:
http://www.ultranet.com/~jkimball/BiologyPages/G/GenomeSizes.html

Genome Sizes

This site lists several organisms, from viruses to humans, and how much DNA
and genes they have.

Here's an interesting tidbit from the site:
<BLOCKQUOTE>quote:</font><HR>Even though Psilotum nudum (sometimes called the "whisk fern") is a
far simpler plant than Arabidopsis (it has no true leaves, flowers, or
fruit), it has 3000 times as much DNA. No one knows why, but 80% or more of
it is repetitive DNA containing no genetic information. This is also the
case for some amphibians, which contain 30 times as much DNA as we do but
certainly are not 30 times as complex.

The total amount of DNA in the haploid genome is called its C value. The
lack of a consistent relationship between the C value and the complexity of
an organism (e.g., amphibians vs. mammals) is called the C value
paradox.<HR></BLOCKQUOTE>

To me, this information supports evolution far more than it supports
intelligent design, especially the part about "80% or more of it is
repetetive DNA."

froggie

 

DAVID PLAISTED

I don't think Froggie ever did answer my question about whether the
pseudogenes common to humans and chimps are 100 percent identical.
I believe that Helen posted an article about large, nonrandom
differences between humans and chimps, and these differences
consist of stretches of DNA with no known analogue in the human
genome. It seems puzzling that chimp DNA should be mostly almost
identical to human DNA but with a few places with large differences.
But this seems almost necessary, given the large differences in
culture and behavior. This appears to be a problem both for creation
and evolution.

Part of the problem with the pseudogenes is this: Suppose there are
many identical pseudogenes between humans and chimps. Now, a typical
gene has about 1000 base pairs of coding DNA but there are also many
introns in the gene. Based on info from the human genome, it looked
to me like the DNA devoted to introns was much more than that devoted
to DNA. I think about 25 percent of the human genome consists of
genes, so the fraction devoted to coding DNA must be tiny (correct if
I am wrong). Suppose each gene has 25 times as much DNA altogether
as coding DNA. In the pseudogenes all this DNA is identical. Say
there are 10 identical pseudogenes. This would be about
250,000 base pairs, all identical between humans and apes. What
mutation rate would explain this? If a one percent difference
corresponds to a divergence 6 million years ago, then in 6 million
years one would expect 2,500 differences in these genes. But there is
not even one, which is too small by a factor of over 2000. This means
that the divergence time is too large by a factor of over 2000, so
the true divergence would be 3000 years ago.

Of course, some genes have more differences than others, but the
point is still that if many genes are completely identical then
this implies a _very_ recent divergence. If these genes are not
completely identical (the pseudogenes) then it becomes difficult
to say that the human and ape pseudogenes were inactivated by the
same mutations.

Dave Plaisted

* * *

a second email arriving shortly after the first added this:

Froggie mentions SINE retroelements and ALU elements at the same place
in organisms that are closely related according to evolution. Again
what we need is a systematic study of many such elements in many
organisms to see the degree of agreement with independently derived
phylogenies, not just specific examples where specific elements
agree. Perhaps other supposed evidences of common descent do not
always agree with SINE retroelements and ALU elements. It is also
possible that transposons are not random in their choice of insertion
site, so that one might find similar insertions in similar organisms.
Dave Plaisted

 

DAVID PLAISTED

Froggie mentions cytochrome C and its differences in different organisms.
She questions why it should differ.
In the first place molecular phylogenies do not always agree with each
other or with the recognized evolutionary patterns, so this is not always
a good argument for evolution.

As for cytochrome C, there are a number of factors that could explain
why it differs in different organisms. Proteins are structured to be
very specific in most cases, which means they only interact with a
select few others. Their structures have to agree in order for this
to happen. Also, they have to _disagree_ with other proteins to prevent
them sticking together or interacting in some undesirable way. This
may constrain the cytochrome C.

It's also interesting that in the process of two proteins docking, other
parts of the protein may be important that are not part of the places
they actually interact. So this is another constraint on their
structure.

Some genes are RNA genes and regulate other genes by the RNA directly
interacting with messenger RNA from the other genes. This could also
help to explain the cytochrome C sequence.

Sometimes RNA itself can be harmful to the organism (the messenger
RNA) which may also constrain cytochrome C and other proteins.

The DNA also tends to be self complementary (each strand) over short
distances, implying that it may form kinks at certain times. This might
also constrain the cytochrome C in different organisms, since the pattern
of self complementarity seems to vary between species.

Dave Plaisted

 

FROGGIE

Hello David,
David stated, "Froggie mentions cytochrome C and its differences in
different organisms. She questions why it should differ. In the first place
molecular phylogenies do not always agree with each other or with the
recognized evolutionary patterns, so this is not always a good argument for
evolution."

So your rebuttal is, "Scientists sometimes disagree?" Can you be more
specific? Please show me data about how scientists debate this particular
phylogeny.


David stated, "As for cytochrome C, there are a number of factors that
could explain why it differs in different organisms. Proteins are structured
to be very specific in most cases, which means they only interact with a
select few others. Their structures have to agree in order for this to
happen. Also, they have to _disagree_ with other proteins to prevent them
sticking together or interacting in some undesirable way. This may constrain
the cytochrome C. "

David, the evidence for evolution here is not that cytochrome C differs,
it's that it differs in a very specific pattern that correlates with
evolutionary theory. Why do we see the specific differences that we do?
Also, the studies I summarized for you would have taken into account other
functions of Cyt C (if there are any). One of them was even in vivo! So
no, your argument does not hold here.


David stated, "It's also interesting that in the process of two proteins
docking, other parts of the protein may be important that are not part of
the places they actually interact. So this is another constraint on their
structure."

Huh? If this was true, it would have been noted in the in vivo studies.
Cyt C functioned the same with large chunks taken out.


David: Some genes are RNA genes and regulate other genes by the RNA
directly interacting with messenger RNA from the other genes. This could
also help to explain the cytochrome C sequence.

No, the studies I mentioned only concern the protein sequences.


David: Sometimes RNA itself can be harmful to the organism (the messenger
RNA) which may also constrain cytochrome C and other proteins.

Please provide references that state that this specific RNA is harmful.


David: The DNA also tends to be self complementary (each strand) over
short distances, implying that it may form kinks at certain times. This
might also constrain the cytochrome C in different organisms, since the
pattern of self complementarity seems to vary between species.

Again, huh? Do you mean RNA here? DNA is double stranded. Again, do you
have any data that suggests this might be true? I know what experiments you
could do to test this theory. Do you?


David: I don't think Froggie ever did answer my question about whether
the pseudogenes common to humans and chimps are 100 percent identical.

Well, you never answered the original question from this thread that I
started: "I’m still waiting for the creationist explanation as to why we
have evidence of chimpanzee chromosome ends in the middle of our
chromosomes."

Incidentally, I did a quick pubmed search on "pseudogenes and evolution" and
came up with 36 pages of abstracts. So the data is there if you want to
sift through it.

And an article from talkorigins had this to say:
http://www.talkorigins.org/faqs/molgen/plaisted.html
<BLOCKQUOTE>quote:</font><HR>Your point #8 suggests that humans and chimps may share pseudogenes
for vitamin C metabolism through independent mutations resulting from loss
of selective pressure to preserve functional genes, or even through
selective pressure to inactivate the genes (your point #9). I fully agree
that this is possible; indeed the history of galactosyltransferase genes
appears to follow a very similar scheme (as I pointed out in the box to
section 4.1). But as I mentioned above, when scientists examine the
mutations in a particular human gene to understand the cause of a genetic
disease, they generally find that many different mutations that can
inactivate a gene. Therefore, as I mentioned in section 4.1, if primates
closely related to humans have the SAME crippling mutations in their LGGLO
pseudogenes as we see in the human pseudogenes, this finding would support
the evolutionary model. As I pointed out, the data on this question are not
yet available for the LGGLO pseudogenes, but in other shared pseudogenes
identical crippling mutations clearly favor evolution (see my section 4.2).
<HR></BLOCKQUOTE>

Although I suspect you have read this before, David.

I don't know if all the pseudogenes are identical. We would not expect them
to be identical because they are pseudogenes, and the selective pressure is
no longer acting on them. They should agree with the time we have alloted
for evolution. I did find this abstract:
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1318388&dopt=Abstract

Calculation
of sequence divergence from the thermal stability of DNA
heteroduplexes.
<BLOCKQUOTE>quote:</font><HR>Measurements are reported of the thermal stability of DNA
heteroduplexes between clones of the eta-globin pseudogene from a variety of
primates. The known sequences of this 7.1-kb region differ from each over a
range from 1.6% for human versus chimp to nearly 12% for human versus spider
monkey. Thermal stability was determined by standard hydroxyapatite thermal
elution, and the results show a precisely linear decrease in thermal
stability with divergence. The slope of the regression line is 1.18%
sequence divergence per degree centigrade reduction in thermal
stability.<HR></BLOCKQUOTE>

David stated, "It seems puzzling that chimp DNA should be mostly almost
identical to human DNA but with a few places with large differences. But
this seems almost necessary, given the large differences in culture and
behavior. This appears to be a problem both for creation and evolution."

It is not a problem for evolution. You already solved the conundrum in your
own post, "this seems almost necessary, given the large differences in
culture and behavior." Evolutionary theory would predict a large degree of
similarity (which we find--over 98%) as well as some key differences that
evolved to make us human. That paper that Helen quoted is exciting science.
Now perhaps we can investigate what makes us truly "human."

David stated, "Part of the problem with the pseudogenes is this: Suppose
there are many identical pseudogenes between humans and chimps. Now, a
typical gene has about 1000 base pairs of coding DNA but there are also many
introns in the gene. Based on info from the human genome, it looked to me
like the DNA devoted to introns was much more than that devoted to DNA. I
think about 25 percent of the human genome consists of genes, so the
fraction devoted to coding DNA must be tiny (correct if I am wrong). Suppose
each gene has 25 times as much DNA altogether
as coding DNA. In the pseudogenes all this DNA is identical. Say
there are 10 identical pseudogenes. This would be about
250,000 base pairs, all identical between humans and apes. What
mutation rate would explain this? If a one percent difference
corresponds to a divergence 6 million years ago, then in 6 million
years one would expect 2,500 differences in these genes. But there is
not even one, which is too small by a factor of over 2000. This means
that the divergence time is too large by a factor of over 2000, so
the true divergence would be 3000 years ago."

Problems with your calculations:
1) I don't think the amount of DNA dedicated to introns is more than that of
exons. Please provide a source for this statement.
2) It is much less than 25% of our genome that is dedicated to actual
protein coding genes. Try around 2%
3) We would expect pseudogenes to differ more between chimps and humans than
actual protein coding genes. You seem to think pseudogenes are expected to
be identical. Remember, as soon as they become a non-functional gene, there
is no selective pressure to keep the gene from mutating, so it should mutate
at random, at rates consistent with what we know about mutation rates.
4) The length of a gene includes the introns (usually), so your estimate of
250,000 is wrong.
5) Where did you see that there was no differences in any of the
pseudogenes? Please provide that data, or a link.


David stated, "Of course, some genes have more differences than others,
but the point is still that if many genes are completely identical then this
implies a _very_ recent divergence. If these genes are not completely
identical (the pseudogenes) then it becomes difficult to say that the human
and ape pseudogenes were inactivated by the same mutations."

Define "recent." Why is it difficult to say that they were inactivated by
the same mutation? You can look at the sequence data, and see that they
have the same mutation.


David stated, "Froggie mentions SINE retroelements and ALU elements at
the same place in organisms that are closely related according to evolution.
Again what we need is a systematic study of many such elements in many
organisms to see the degree of agreement with independently derived
phylogenies, not just specific examples where specific elements agree.
Perhaps other supposed evidences of common descent do not always agree with
SINE retroelements and ALU elements. It is also possible that transposons
are not random in their choice of insertion site, so that one might find
similar insertions in similar organisms."

Again, a search at pubmed under "SINES and evolution" yielded 169 abstracts,
so the data is out there.
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11441184&dopt=Abstract

Here's one abstract:
<BLOCKQUOTE>quote:</font><HR>To illuminate the function and evolutionary history of both genomes,
we sequenced mouse DNA related to human chromosome 19. Comparative sequence
alignments yielded confirmatory evidence for hypothetical genes and
identified exons, regulatory elements, and candidate genes that were missed
by other predictive methods. Chromosome-wide comparisons revealed a
difference between single-copy HSA19 genes, which are overwhelmingly
conserved in mouse, and genes residing in tandem familial clusters, which
differ extensively in number, coding capacity, and organization between the
two species. Finally, we sequenced breakpoints of all 15 evolutionary
rearrangements, providing a view of the forces that drive chromosome
evolution in mammals.<HR></BLOCKQUOTE>

I think that's enough for now. I'm tired, and going to sleep now!

froggie