Humans and Chimps

Discussion in 'Creation vs. Evolution' started by Administrator2, Jan 23, 2002.

  1. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    FROGGIE
    Similarities between human and chimp chromosomes: Evidence of a common
    creator, or common descent?

    I think we can all agree that humans and chimpanzees share some remarkable
    similarities. Not only do we look alike at the macro and micro level, we
    also have some behavioral similarities. Now, these similarities alone do
    not prove the theory of evolution. They could simply be evidence of
    a common creator.

    Let's look at one particular piece of evidence in more detail. Before we
    even knew what chromosomes were, scientists speculated that humans and
    chimps descended from a common ancestor. After scientists started studying
    DNA, the similarities were striking, and further supported this theory.
    Here's a picture from the

    evolution evidence page http://www.gate.net/~rwms/hum_ape_chrom.html
    http://www.gate.net/~rwms/hum_ape_chrom_2.gif

    Human Chromosome 2 and its analogs in the apes. H=human, C=chimp, G=gorilla,
    O=orangutan.

    The black lines are where the chromosomes have similar G-banding patterns.
    Humans have 46 chromosomes (23 in sperm and eggs), and chimps have 48 (24 in
    sperm and eggs). This may seem at first to be a problem for evolutionary
    theory. Shouldn't we have the same chromosome number? Well, scientists
    hypothesize that a chromosome fusion event occurred somewhere along the
    evolutionary path, and this is why humans have one less chromosome in the
    haploid genome. If you look at the picture again, you can see how the two
    primate chromosomes do resemble the one human chromosome.
    <BLOCKQUOTE>quote:</font><HR>From the evolution evidence page:
    There are two potential naturalistic explanations for the difference in
    chromosome numbers - either a fusion of two separate chromosomes occurred in
    the human line, or a fission of a chromosome occurred among the apes. The
    evidence favors a fusion event in the human line. One could imagine that
    the fusion is only an apparent artifact of the work of a designer or the
    work of nature (due to common ancestry). The common ancestry scenario
    presents two predictions.
    Since the chromosomes were apparently joined
    end to end, and the ends of chromosomes (called the telemeter ) have a
    distinctive structure from the rest of the chromosome, there may be evidence
    of this structure in the middle of human chromosome 2 where the fusion
    apparently occurred. Also, since both of the chromosomes that hypothetically
    were fused had a Centro mere (the distinctive central part of the
    chromosome), we should see some evidence of two centromeres.<HR></BLOCKQUOTE>
    So while both creationists and evolutionists could use the similar
    chromosomes as evidence for their theory, only evolutionary theory makes
    detailed predictions about specific things we would find in the chromosomes.
    Do these predictions come true?
    <BLOCKQUOTE>quote:</font><HR>From the evolution evidence page:
    The first prediction (evidence of a telomere at the fusion point) is shown
    to be true in reference 3 . Telomeres in humans have been shown to consist
    of head to tail repeats of the bases 5'TTAGGG running toward the end of the
    chromosome…When the vicinity of chromosome 2 where the fusion is expected to
    occur…is examined, we see first sequences that are characteristic of the
    pre-telomeric region, then a section of telomeric sequences, and then
    another section of pre-telemetric sequences. Furthermore, in the telomeric
    section, it is observed that there is a point where instead of being
    arranged head to tail, the telomere repeats suddenly reverse direction…and
    the second pre-telomeric section is also the reverse of the first telomeric
    section. This pattern is precisely as predicted by a telomere to telomere
    fusion of the chimpanzee (ancestor) 2p and 2q chromosomes, and in precisely
    the expected location.
    The second prediction - remnants of the 2p and 2q centromeres is documented
    in reference 4. The normal centromere found on human chromosome 2 lines up
    with the 2p chimp chromosome, and the remnants of the 2q chromosome is found
    at the expected location based upon the banding pattern. <HR></BLOCKQUOTE>
    The answer--yes, the predictions that evolutionary theory made did indeed
    come true. I now ask any creationist to come up with a better explanation
    as to why these specific similarities and differences occur in the
    chromosomes? If humans and chimps were 'created separately,' why the
    incredible coincidence of what looks like chromosome fusion? Why would a
    creator put evidence of telomeres in the middle of the human chromomsome?
    Why don't chimps have, say 32 chromosomes with their genes in a different
    order?

    Another question that you may have is how the fusion could have occurred,
    and survived, since many chromosome anomalies are deadly or sterile.
    <BLOCKQUOTE>quote:</font><HR>From the evolution evidence page:
    Some may raise the objection that if the fusion was a naturalistic event,
    how could the first human ancestor with the fusion have successfully
    reproduced? We have all heard that the horse and the donkey produce an
    infertile mule in crossing because of a different number of chromosomes in
    the two species. Well, apparently there is more to the story than we are
    usually told, because variations in chromosome number are known to occur in
    many different animal species, and although they sometimes seem to lead to
    reduced fertility, this is often not the case. Refs 5, 6, and 7 document
    both the existence of such chromosomal number differences and the fact that
    differences do not always result in reduced fertility. I can provide many
    more similar references if required. The last remaining species of wild
    horse, Przewalski's (sha-val-skis) Wild Horse has 66 chromosomes while the
    domesticated horse has 64 chromosomes. Despite this difference in chromosome
    number, Przewalski's Wild Horse and the domesticated horse can be crossed
    and do produce fertile offspring. <HR></BLOCKQUOTE>
    So this chromosome fusion event fits with the evolutionary model, the
    chromosomes have over 99% similarity and in the right order, there is direct
    evidence of fusion in the human chromosome, and it is feasible, since
    animals with different chromosome numbers have produced viable offspring.
    How does YEC account for all of these amazing "coincidences?"

    froggie

    [ January 23, 2002: Message edited by: Administrator ]
     
  2. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    HELEN
    Hi froggie,
    This is a little harder responding this way! I have to copy your post onto an email or Word page to see it!

    Oh well. You asked for specific responses to a specific thing. I can't do that. So I certainly won't pretend. And, thus, I won't take up much time with this response. But I would want to say that, considering the
    evident evidence that we are genetically 99% the same as chimps, and then looking at them and looking at us, my only possible response is something along the lines of "well, genetics certainly doesn't tell the whole story then, does it?"

    What might be interesting to note, though, is that Science for Jan. 4, 2002 has what appears to be an interesting article. I only have access to the abstract at this point, but the last sentence in this abstract
    grabbed my attention. Here it is:

    Construction and Analysis of a Human-Chimpanzee Comparative Clone Map
    Asao Fujiyama,12* Hidemi Watanabe,1* Atsushi Toyoda,1* Todd D. Taylor,1* Takehiko Itoh,3* Shih-Feng Tsai,45* Hong-Seog Park,6* Marie-Laure Yaspo,7* Hans Lehrach,7 Zhu Chen,8* Gang Fu,8* Naruya Saitou,2* Kazutoyo
    Osoegawa,9 Pieter J. de Jong,9 Yumiko Suto,10 Masahira Hattori,1* Yoshiyuki Sakaki111*

    The recently released human genome sequences provide us with reference data
    to conduct comparative genomic research on primates, which will be important
    to understand what genetic information makes us human. Here we present a
    first-generation human-chimpanzee comparative genome map and its initial
    analysis. The map was constructed through paired alignment of 77,461 chimpanzee bacterial artificial chromosome end sequences with publicly available human genome sequences. We detected candidate positions, including two clusters on human chromosome 21 that suggest large, nonrandom
    regions of difference between the two genomes.


    So I guess my question is, do we really have enough evidence in to make a judgment about even the genetic similarity between man and chimp?

    Helen
     
  3. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    FROGGIE
    Hello Helen, thank you for your reply.
    Helen stated, “So I guess my question is, do we really have enough evidence
    in to make a judgment about even the genetic similarity between man and
    chimp?”

    The first thing I thought about when answering this question was, well, me!
    See, I used to be a tadpole. I had gills, and I had a tail instead of arms
    and legs. Now I hop around on four legs, breathe through my lungs and my
    skin, and my tail has disappeared. What is the difference between my
    genomic DNA then, and now? Assuming no mutations, Zero. Gene
    expression makes all the difference. So yes Helen, the answer to
    your question-hypothetically-is “Yes.”

    Let’s look at that paper further (which I happen to have right here).
    First off, the author’s conclusions:
    <BLOCKQUOTE>quote:</font><HR>We detected candidate positions, including two clusters on human
    chromosome 21 that suggest large, nonrandom regions of difference between
    the two genomes.<HR></BLOCKQUOTE>
    Note the words “large difference” here. What did these scientists do?
    Well, this is a pretty technical paper but I will try to outline it for
    everyone. Keep in mind that most of the human genome is sequenced and in a
    database. So, these scientists generated a library of chimpanzee genomic
    sequences. This is done by cuttting up the chromosomes and sticking them
    into expression vectors. This is done because you can’t sequence a
    full-length chromosome in one sequencing reaction! Anyway, they took each
    sequence and compared each one to the human genome database. In the paper
    the pieces were called bacterial artificial chromosome end sequences or BECs
    (the bacteria is the vector—we are still talking about chimp DNA ok!).

    About the BECs: “Most BECs have higher identity, we also found the
    existence of many lower-identity BECs in the genome.” They started with
    114,421 pieces of chimp DNA. 77,461 of these pieces matched over 90% to a
    human sequence. This leaves 36,960 pieces which don’t match.
    1. 1168 of them were “repeat” sequences (repetitive DNA which we think has
    no function).
    2. 515 pieces matched a species other than human.
    3. 20,376 matched human sequences in a different database.
    This leaves 14,901 pieces which did not match to humans. There are several
    possibilities for these sections:
    A. Perhaps they match to a human region that hasn’t been sequence yet.
    B. They belong to regions which have diverged substantially from humans
    (and are true chimp-specific genes).
    Their calculation of percent identity is 98.77% between human and chimp.
    This number can vary depending on how you do the calculation, but is always
    between 98 and 99%.

    Then they looked at specific regions. In chromosome 10 (12 in humans) they
    found something interesting. They found a sequence of genes that were
    inverted in gorilla and chimp, as opposed to human and orangutan. “The
    effect of the inversion on these genes should be the target of future
    studies.”

    On chromosome 21, they found 7 sites that were exclusive to humans,
    “suggesting that these loci might correspond to insertions that are specific
    to the human lineage.”

    Helen asked, “evident evidence that we are genetically 99% the same as
    chimps, and then looking at them and looking at us, my only possible
    response is something along the lines of "well, genetics certainly doesn't
    tell the whole story then, does it?"”

    Indeed, Helen is correct. Like my tadpole to frog transition above,
    obviously the raw DNA sequence is not enough to account for differences in
    phenotypes. Gene expression is very important. Remember my note above
    about the genes found in an inverted order? Well, this could be an
    important regulatory feature of the genes. Also remember that many genes
    are pleiotropic, meaning they have more than one function. This is another
    way that only a 1 or 2% difference could cause major changes. Third, let’s
    really look at 1%. I’ll use the most conservative difference here being one
    percent. 1% of 3 x10e9 is still thirty million differences. Let’s assume
    that only 3% of the genome even matters. Thats 0.03 x 0.01 x 3x10e9 which
    is nine hundred thousand differences between humans and chimps. Did
    evolution have enough time to get this many differences? If you consider
    macrogenetic changes such as gene duplications and chromosome fusions in
    addition to point mutations, absolutely. Is this many differences enough to
    account for human and chimp differences? Anyone who understands gene
    regulation will give you an emphatic “Yes indeed.”

    I’m still waiting for the creationist explanation as to why we have evidence
    of chimpanzee chromosome ends in the middle of our chromosomes.

    froggie
     
  4. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    DAVID PLAISTED
    I think it's best not to become obsessed with the human-chimp relationship, though it has a lot of interest for us personally. This reminds me of a situation I had when writing an program and worked hard to optimize it for a particular set of inputs. Then it turned out not to work well for a wider range of inputs. We should look at the overall evolutionary scenario and see how it works instead. Even some creationists have proposed that apes are degenerated humans (I once heard) or maybe humans are degenerated apes or both degenerated from something else. Another thing to keep in mind is that all the mammals are similar genetically (even humans and mice) and when you add this to the morphological similarity between humans and apes it is not surprising that one can get a 98 percent similarity or whatever it is. Also there are epigenetic factors that can influence the expression of genes, that are not even part of the DNA, and this can account for more differences. A recent article in science mentioned surprisingly rapid evolution of finches in two regions of the USA, so one could get a lot of change in a short time. But I will be interested to see whatever the biologists can uncover about the relationship between humans and apes.

    Dave Plaisted
     
  5. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    [Administrator: RufusAtticus requested the entire abstract be available which Helen had referred to. The article itself cannot be accessed unless you subscribe to Science.]

    RUFUSATTICUS

    Fujiyama A et al. "Construction and analysis of a human-chimpanzee
    comparative clone map." Science 2002 Jan 4;295(5552):131-4

    Pubmed database entry: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&list_ui
    ds=11778049&dopt=Abstract

    [ January 28, 2002: Message edited by: Administrator ]
     
  6. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    SCOTT PAGE

    [response to Plaisted:]
    I am always a bit perplexed when I see such sentiments. To the best of my knowledge, no genes controlling or directly influencing morphology have been discovered, much less sequenced and compared with those of other species. The genes and non-genic regions that have been analyzed deal largely with physiology (if anything). What is the logic employed to conclude that because humans and chimps have a similar outward morphology, we should expect genes involved in encoding proteins involved in doing things like carrying oxygen or playing a role in blood clotting to show the same hierarchical patterns hypothesized under evolutionary assumptions?
     
  7. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    FROGGIE
    Thanks for everyone's replies.
    David Plaisted had commented, "I think it's best not to become obsessed with
    the human-chimp relationship, though it has a lot of interest for us
    personally. "

    I am choosing to focus mainly on human-chimp evolution for this forum,
    mainly because in my experience with debating creationists at infidels, it's
    the only relationship that matters to their faith. If fish evolved
    from frogs, no matter. It's the "humans evolved from apes" bit that seems
    to be the main objection for a majority of creationists.

    Furthermore for me as a future doctor, human medicine in the context of
    evolution is an important concept. Baptists on this forum may think my
    motivations here are to irritate them but this is not entirely the
    case ;) . I honestly believe that studying how humans evolved will give us
    unique insights into our human-ness (our violent tendencies, addictive
    behaviors, and how we get diseases are some examples). Thus, creationists
    are in a way stagnating human understanding and progress.


    DP: This reminds me of a situation I had when writing an program and worked
    hard to optimize it for a particular set of inputs. Then it turned out not
    to work well for a wider range of inputs. We should look at the overall
    evolutionary scenario and see how it works instead.


    This has been done. There is a plethora of evidence which supports
    evolutionary theory, from bacteria to mammals.


    DP: Another thing to keep in mind is that all the mammals are similar
    genetically (even humans and mice) and when you add this to the
    morphological similarity between humans and apes it is not surprising that
    one can get a 98 percent similarity or whatever it is.


    Ok, I see your point. Our genetics and our morphology are of course
    related, so animals similar in morphology would be expected to have similar
    genetics (whether due to common creator or evolution).

    Until you realize that much of the genetic data is not necessarily related
    to morphology. Go back up and click on the human and chimp chromosome image
    again. Why are the G-banding patterns so consistent? Much of these G-bands
    are in our non-coding, or "junk" parts. Why is the junk so similar? I
    think YEC would not predict this observation.

    And why such a similar number of chromosomes, consistent with a chromosome
    fusion event? Chromosome number, as well as DNA content per cell, does not
    correlate with morphology or complexity, so Dave's argument doesn't really
    hold when you look at "the overall evolutionary scenario."

    Also, think about gene duplication. This occurs when chromosomes line up
    during meiosis, and unequally cross over. Thus, one sperm or egg gets two
    copies of a gene (the other sperm or egg gets none, and most likely dies).
    Many genes have duplicated and diverged in this manner, and their
    duplication can be traced along evolutionary trees. For example, in an
    early lineage, you will find one gene. Then in a later lineage, you will
    find two copies in tandem. Then still later, four in a row (two times two).
    Ok, you could still claim "common creator" but evolution gives such a
    great explanation-it explains the mechanism as well as the
    similarities.


    DP: recent article in science mentioned surprisingly rapid evolution of
    finches in two regions of the USA, so one could get a lot of change in a
    short time.


    Volume and page number please? I believe I read the article you are
    refering to. Usually rapid means
    100,000 years instead of 1,000,000, not 6000 years instead of 1,000,000.

    I’m still waiting for the creationist explanation as to why we have evidence
    of chimpanzee chromosome ends in the middle of our chromosomes.

    froggie
     
  8. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    DAVID PLAISTED
    I am perplexed and astonished at the statement that morphology has little
    to do with genetics, as if the overall form of an organism is somehow
    pasted on with little relation to its biology. The organism is a unit
    and one would expect similar morphology to correlate with similar
    genetics.
    David Plaisted
     
  9. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    DAVID PLAISTED
    Froggie mentions that the G banding patterns are similar in humans and
    chimps. Again, I think this is an evidence of a fixation on this one
    issue. What we need is to look at G banding patterns of many
    organisms, many mammals and maybe some non-mammals too. Then we can
    evaluate the significance of the commonalities between humans and
    apes. Froggie mentions that this common pattern even occurs in junk
    regions. We still don't know much about the junk DNA but it could
    have a function. I saw a web page that asserted the DNA (each strand)
    tends to be complementary to _itself_ over certain short distances and
    this pattern is often consistent and preserved when other things
    change. It's as if the DNA forms little U's all along itself at some
    point. Anyway, for the junk DNA as well it would help to know more
    about the patterns in a wider variety of organisms.
    Dave Plaisted
     
  10. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    FROGGIE
    Hello again,
    I have a small request of anyone replying to me here. Could you please
    indicate to me your background in genetics? This is for your benefit--I
    don't want to talk down to you or over your head, and knowing your
    background would help tremendously! For the record, I have a bachelor's in
    molecular and cellular biology, and a (nearly completed) master's degree in
    cell biology and immunology, with several graduate courses dedicated to
    genetics and gene expression.

    David Plaisted commented, "I am perplexed and astonished at the statement
    that morphology has little to do with genetics, as if the overall form of an
    organism is somehow pasted on with little relation to its biology."


    David, what I said was, "Until you realize that much of the genetic data is
    not necessarily related to morphology."

    The genetic data I am speaking of is not the actual genes and the proteins
    they code for. I am speaking of the patterns of the genes on the
    chromosomes.

    What you are talking about, I think, is this: If the genetic code makes us
    who we are, than a genetic code which makes a heart in a dog will be very
    similar to the code that makes our heart. Is this what you mean? If so, I
    agree. Similarity of the genes alone does not prove evolution--it could
    still be evidence of a common designer.

    But this is not the evidence I am talking about. Here is another quote from
    the evolution evidence page (linked to in my first post above):
    <BLOCKQUOTE>quote:</font><HR>When one looks at the chromosomes of humans and the living great apes
    (orangutan, gorilla, and chimpanzee), it is immediately apparent that there
    is a great deal of similarity between the number and overall appearance of
    the chromosomes across the four different species...Furthermore, these
    diagrams show the similarity of the chromosomes in that every one of 1,000
    nonheterochromatic G-bands has been accounted for in the four species. That
    means that each non-heterochromatic band has been located in each species.

    The following observations can be made about similarities and differences
    among the four species. Except for differences in non genetic
    heterochromatin, chromosomes 6, 13, 19, 21, 22, and X have identical banding
    patterns in all four species. Chromosomes 3, 11, 14, 15, 18, 20, and Y look
    the same in three of the four species (those three being gorilla, chimps,
    and humans), and chromosomes 1, 2p, 2q, 5, 7 - 10, 12, and 16 are alike in
    two species.
    Chromosomes 4 and 17 are different among all 4 species.

    Note how all of the bands between the two chromosomes will line up
    perfectly if you flip the middle piece of either of the two chromosomes
    between the p14.I and q14.I marks.
    The similarity of the marks will
    include a match for position, number, and intensity (depth of staining).
    Similar rearrangements to this can explain all of the approximately 1000
    non-heterochromatic bands observed among each of the four species for these
    three properties (band position, number, and intensity). <HR></BLOCKQUOTE>

    These "genetic similarities" have nothing to do with the actual protein
    products. They are simply stretches of G's in the sequence. Even if they
    do have a function, this still does not explain why we primates all have the
    same pattern of G bands. Our genes are not in any particular order that we
    can ascertain. For example, I study an enzyme called NADPH oxidase, which
    helps neutrophils fight off bacteria. It is a multi-protein complex. The
    genes for each protein are found on completely different chromosomes, so
    obviously their order and placement on our chromosomes do not affect their
    function (i.e. they don't need to be together to work, and usually they are
    not coded together). So, if chimps were created separately from humans, why
    do they have not only the same genes, but also the same orders of genes,
    when it is pretty clear that the order and placement of genes does not
    really matter much?

    Let's try a little experiment. Let's say I I wanted to recreate your post on
    a word document but with ee cummings rules (no caps nor punctuation), I
    could do one of two things.

    1) I could create it separately by typing everything that I see but adding
    changes along the way. You would expect to see similarities of course,
    because I am trying to copy your post. You would perhaps expect to see some
    errors too.
    2) I could use the quote function on UBB. In this case, I would want to
    delete all UBB codes as well as the ee cummings stuff. If I messed up and
    left a part of UBB in, then there in the text, for everyone to see, would be
    evidence that I used the quote function.

    Here is the result of method #1 (common designer analogy):

    david plaisted
    i am perplexed and astonished at the staemnt that morphology has little to
    do with genetics as if the overall form of an organism is somehow psated on
    with little relation to its biology the organism is a unit and one would
    expect similar morphology to correlate with similar genetcs
    david plaisted

    Here's a pretend recreation of #2 (evolution method):

    david plaisted
    I am perplexed and astonished at the statement that morphology has little to
    do with genetics as if the overall form of an organism is somehow pasted on
    with little relation to its biology the organism is a unit and one would
    expect similar morphology to correlate with similar
    genetics
    david plaisted [/quote]

    There, in my post is evidence not only that I copied your post but also an
    explanation as to how I copied it. Now, how likely is it that I
    accidentally type out the /quote thing if I am coping what I see on the
    screen? Not very, because UBB code is not visible to me.

    The leftover quote function is analogous to the chimp telomere sequence in
    the middle of the human chromosome. This genetic marker indicates that
    chimps and humans diverged from a common ancestor, and it also offers one
    piece of evidence how this divergence occured. Gene duplications,
    such as the various forms of hemoglobin, are also evidence of not only
    common descent but also how the evolution occured. You will find for
    example this sequence in the most 'primitive' species (I bolded the
    theoretical gene):

    AATCAGATGACTATGCTAGCTAGC

    Then this part of the DNA became duplicated, giving the new organism two
    genes to evolve instead of one.
    AATCAGATGACTATGCTAGCTAGCAATCAGATGACTATGCTAGCTAGC

    Then this region in the DNA gets duplicated again (probably more than just
    this region, but anyway), and you will find this sequence in a more recently
    evolved organism:

    AATCAGATGACTATGCTAGCTAGCAATCAGATGACTATGCTAGCTAGCAATCAGATGACTATGCTAGCTAGCAATCAGATGACTATGCTAGCTAGC

    Now there are four copies of the gene.

    There, in the sequence, is evidence of gene duplication staring you in the
    face. (Note here: this is what happened in many gene lineages--I will link
    to the actual science later when I am confident this concept is being
    understood. If you want to know how gene duplications happen, I made a
    little drawing in my formal debate with Douglas J Bender called
    "Macroevolution" something or other in the "Formal Debates and Discussions"
    at infidels.org (can't link to it here). Scroll down until you see pictures
    of chromosomes that I made on Paint.)


    froggie
     
  11. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    SCOTT PAGE

    <BLOCKQUOTE>quote:</font><HR>I am perplexed and astonished at the statement that morphology has little to do with genetics, as if the overall form of an organism is somehow pasted on with little relation to its biology. The organism is a unit and one would expect similar morphology to correlate with similar genetics.
    David Plaisted<HR></BLOCKQUOTE>

    You misrepresent my position. I did not say that morphology is independent of genetics. What I plainly explained is that at this time, NOT A SINGLE GENE controlling or influencing morphology has been sequenced and compared to other species. I further explained that the genes that have been sequenced and compared are involved in physiological aspects such as oxygen transport or the visual cascade. That is not morphology. Certainly , we should expect the genes that control/influence morphology in apes and humans to be similar. But there is no logic behind the notion that, were we all separate creations, we should expect such genes as hemoglobin to exhibit the patterns that we observe.

    Perhaps you can explain, David, why we should expect genes that have no (known) influence on morphology and non-genic, non-regulatory sequences to correlate with morphology.

    Please provide citations as well.

    Thanks,

    Scott Page

    [Administrator: citations are not requested or required by the Baptist Board, as this is a place for exchanging viewpoints and exposing those watching to the different arguments used by each side.]
     
  12. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    DAVID PLAISTED
    Thanks, Froggie, for the good post. Again this is a case of over
    emphasis on one problem, the human-ape relationship. We should also
    look at the sequences of genes for monkeys and other mammals, cats and
    mice and horses etc. to see what the general trends are. There may
    be reasons that the genes have a particular sequence on the
    chromosome, having to do with how or when they are expressed.

    Scott, even basic biology will be influenced by the bodily form
    because it influences all aspects of an organism. I think what we have
    here is a view of biology that attempts to make the correlation between
    morphology and genetics an evidence for evolution, when in reality
    it is not.

    Dave Plaisted
     
  13. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    SCOTT PAGE
    <BLOCKQUOTE>quote:</font><HR>Scott, even basic biology will be influenced by the bodily form
    because it influences all aspects of an organism. I think what we have
    here is a view of biology that attempts to make the correlation between
    morphology and genetics an evidence for evolution, when in reality
    it is not.
    <HR></BLOCKQUOTE>

    Interesting. I was unaware that oxygen carrying molecules would be influenced by ‘bodily form.’ I teach biology at the college level, and did research in molecular phylogenetics for my doctorate, and I have never heard any such thing before.

    What I find especially odd is that your last sentence is in fact nearly the opposite of what I have been writing. Unless, of course, you were referring to your own position?

    Scott Page
     
  14. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    FROGGIE
    David stated: Thanks, Froggie, for the good post.

    You are welcome. It was fun to write, actually.

    David: There may be reasons that the genes have a particular sequence on
    the chromosome, having to do with how or when they are expressed.[...]I
    think what we have here is a view of biology that attempts to make the
    correlation between morphology and genetics an evidence for evolution, when
    in reality it is not.


    You are saying a couple of things here. First I will address the sequence
    similarity issue. You are correct in stating that a position of genes can
    be important. If you move a gene away from its promotor, it cannot get
    switched on. However, there seems to be no good reason (other than the
    evolutionary explanation) why the genes are oriented in such a bizarre way
    in the first place. Perhaps there is one that hasn't been discovered yet.

    When we compare among species the patterns, sequences, and orientations of
    all these crazy things like pseudogenes, they correlate very well with the
    phylogenetic trees that biologists drew before they even had genetic data!
    Until scientists come up with a better biological reason as to why our
    pseudogenes (and retroviruses, and G bands, etc) are all placed
    strategically in an order just like our alleged ancestors, I will stick with
    the evolutionary explanation.

    My colleague (Oolon from infidels, a fellow scientist) recently gave this
    great example:
    <BLOCKQUOTE>quote:</font><HR>If life evolves by descent with modification, by copying genetic
    material down generations, then we would expect that copying errors in
    non-functioning DNA would only be present in some groups. While there may be
    some reason why functioning DNA is similar in similar groups, there is no
    reason why there should be homologies in DNA that does nothing, unless it
    comes from a common ancestor. For instance, pseudogene equivalents are genes
    which are identifiable as some functional gene in another organism, but
    which have a mutation which has rendered them non-functional. There are
    three sets of genes found in many species that have pseudogene equivalents
    in primates, including humans, but not in other mammals: several odorant
    receptor genes; the RT6 protein gene; and the galatosyl transferase gene.
    The mutations which made these genes inoperable are shared among the
    primates. There are numerous mutations that can render a gene
    non-functional. Yet not only do primates have pseudogene versions of these
    genes that are functional in other creatures, but these pseudogenes have
    been made nonfunctional by the same mutations – they have the exact same
    errors in the genes. This makes perfect sense if this genetic material was
    inherited from a common ancestor.<HR></BLOCKQUOTE>

    So, I guess the burden of proof is on the creationists now. Evolution has a
    satisfactory explanation as to why our 'useless' DNA is there, and why it is
    in a certain place. If this DNA serves a function both in its sequence and
    in its location, let's see the data.

    On to the morphology arguments:

    How our genes dictate our morphology is an interesting and fascinating
    puzzle for scientists. Indeed, one of my favorite biology classes as an
    undergraduate was embryology. How do our cells 'know' to become vastly
    different types of cells, such as muscle and nerve cells, when they all have
    the same exact DNA? Gene expression is the key.

    I disagree with you that the correlation between morphology and gene
    expression does not provide evidence of evolution. Descent with
    modification assumes that organisms come into existence by modifying
    previous structures. This assumption would make the following predictions:

    1) We would expect similar mechanisms for development, coded by similar DNA,
    when you compare species.

    Anyone that has taken embryology has learned that nature uses similar
    patterns over and over to grow organisms from a single cell. Drosophila has
    a set of genes called the homeobox genes, which regulate development using
    nifty gradient tricks. We have four copies of these genes, called the HOX
    genes, which play a similar role in human development. When you look at our
    immune system genes, it appears that mammals 'borrowed' the drosophila
    signal transduction system and simply modified it.

    2) We would expect to remnants of 'instructions' for our ancestors body
    plans in our DNA.

    Do we find these remnants? Check out this web site on hen's teeth:
    http://www.devbio.com/chap06/link0601.shtml

    <BLOCKQUOTE>quote:</font><HR>In 1980, Kollar and Fisher performed a simple experiment with
    remarkable results. They took presumptive jaw epithelium...of 5-day chick
    embryos, and they combined this epithelium with the molar mesenchyme of
    16-day to 18-day mouse embryos. These tissues were allowed to adhere to each
    other, and the mouse molar mesenchyme/chick jaw epithelium recombinants were
    then cultivated within the anterior chamber of a mouse eye. Several of these
    aggregates resulted in the formation of a particularly interesting
    structure--a hen's tooth. These teeth were not like that of mammals.
    Thus, the cells of the chick pharyngeal arches, which have not made teeth
    for nearly 100 million years, still appear to have retained the genetic
    potential to respond to an appropriate inducer.
    <HR></BLOCKQUOTE>
    Before these studies, scientists hypothesized that modern birds evolved from
    predecessor birds that had teeth (fossils had been found of prehistoric
    birds with teeth). These teeth are distinct from mammalian teeth. So, now
    these scientists show that indeed, the DNA coding for these ancient teeth is
    still present in these birds. At some point along evolution, these teeth
    lost their usefulness, but the DNA was still there.

    There are other examples too. Here's a brilliant summary of this concept
    provided by a colleague (Oolon from infidels):
    <BLOCKQUOTE>quote:</font><HR>If life evolves by adaptation of pre-existing genetic recipes... we
    would expect there to be signs of this: genetics tells us that phenotypic
    effects are the result of genes being switched on or off during the making
    of a body (plus environment of course), so a feature being lost does not
    automatically mean that the DNA has been lost too – the genes may just be
    inactive. Evolution thus predicts not only genetic homologies...but also
    that sometimes there would be tell-tale ‘errors’, when normally unused old
    genes become expressed. No surprise to an evolutionist, then, that horses
    with three-toed feet are occasionally born, as are, more rarely, whales with
    hind limbs. Most living insects have two pairs of wings; flies (Diptera),
    which normally have a single pair, sometimes grow a second pair of wings
    instead of halteres (balancing organs). As at 1985, twenty-three cases of
    humans born with tails had been documented in the literature, and many more
    of congenital hypertrichosis (babies covered all over in thick hair). Need I
    mention that having a tail is typical of vertebrates, and being covered in
    hair is a distinguishing feature, the default, of mammals? And there’s more.
    Surgical manipulation of a chicken's foetus(sic) can induce structures to
    grow that normally would not. Experiments have shown that chick embryonic
    jaw tissue can be persuaded to grow teeth in the right conditions, though no
    modern bird possesses teeth (but fossil ones do). The genetic instructions
    for their growth are present, even though they are not usually expressed.
    Furthermore, the growth of some structures induces the growth of others. The
    fibula in modern birds is normally just an (atrophied) splinter, and the
    tarsals are fused. Both reptiles and Archaeopteryx have full tibia and
    fibula and lots of separate tarsals. By simply inserting a piece of mica
    between the developing tibia and fibula of a chick embryo, Armand Hampé
    produced an archaeopteryx-like leg, with not only a fibula fully to the
    ankle, but separate tarsals.<HR></BLOCKQUOTE>

    So, if you do as David suggested and "look at the sequences of genes for
    monkeys and other mammals, cats and mice and horses etc. to see what the
    general trends are," it is obvious to me that the evoutionary explanation is
    the winner. Not only does it explain kooky things like human tails, hen's
    teeth, and pseudogenes, it also predicts them.

    froggie
     
  15. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    DAVID PLAISTED
    Froggie (who used to be a tadpole) says that there are similarities
    in junk DNA and pseudogenes that correlate with evolutionary phlylogenies
    known before the DNA was analyzed. I assume that there has been
    some kind of systematic study with lots of data that shows such a
    correlation? These phylogenies themselves are subject to modification.
    It also depends how far back the phylogenies go. Creationists allow
    a certain amount of evolution and so the observed correlations could
    give a clue as to which organisms came from a common ancestor.

    Along this line, chickens may have had teeth at one time. Degeneration
    does not contradict creationist views.

    However, I am uncertain what it means when Oolon says that a variety
    of pseudogenes exist in many primates, but are active in other
    mammals, and the inactivating mutations are identical in all these
    primates. A typical gene has 1000 base pairs of coding DNA and
    the chimp-human difference is one or two percent (say two) and for
    other apes it is larger. This would give 20 differences in this
    gene, 10 mutations per lineage, and more for other apes. So the
    pseudogenes cannot be identical, right? So among these 20 differences,
    do we know which one inactivated the gene? Or is it just assumed that
    the one that they have in common did it?

    Another thing is that if the genes were inactivated before the
    assumed split then there should be some mutations even before the
    split, and some of these might insert stop codons or whatever and also
    inactivate the gene again.

    Also, it is logical that primates, with their agility and intelligence,
    may not need some genes (like the one for Vitamin C). In this case
    it is an advantage to deactivate the gene because the organism need not
    expend energy making the protein. Thus when such a mutation occurs it
    can spread to the whole population. Now, of all mutations, the great
    majority will not deactivate the gene. Thus there are not many
    mutations altogether that will, probably frame shifts and some others.
    Among these, some may be much more likely to occur than others, and
    this pattern may be common to all the primates, so it is possible that
    the same mutation could spread in all the populations.

    Instead of just looking for cases where the primates have similarities
    we have to be careful to look at all pseudogenes and see if there is a
    pattern.

    There are also many dramatic cultural differences that set man apart
    from all the other primates. These must have some biological basis,
    even if we haven't discovered it yet.

    David Plaisted
     
  16. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    FROGGIE

    Hello again,
    David stated, "Froggie (who used to be a tadpole) says that there are
    similarities in junk DNA and pseudogenes that correlate with evolutionary
    phlylogenies known before the DNA was analyzed. I assume that there has been
    some kind of systematic study with lots of data that shows such a
    correlation?"


    Yes, there have been many studies.
    http://talkorigins.org/faqs/comdesc/section4.html

    Talkorigins, in
    the article "29 Evidences for Macroevolution," is a good place to start.

    <BLOCKQUOTE>quote:</font><HR>Both functional and nonfunctional genetic characters are routinely
    compared. Studies of functional elements include ribosomal RNA, ubiquitous
    proteins, and mitochondrial DNA comparisons; studies of nonfunctional
    elements include comparisons of pseudogenes, endogenous retroviral genes,
    and mobile genetic elements (such as introns, transposons, or
    retroelements)<HR></BLOCKQUOTE>

    The author then talks about a protein called cytochrome C--which is present
    in all organisms from yeast to mammals. This protein is rather interesting.
    It differs about 40% between humans and yeast. But the differences do not
    seem to alter the function of the protein!

    <BLOCKQUOTE>quote:</font><HR>It has been shown that the human cytochrome c protein works just fine
    in yeast (a unicellular organism) that lacks its own native cytochrome c
    gene, even though yeast cytochrome c differs from human cytochrome c over
    40% of the protein...In fact, the cytochrome c genes from tuna, pigeon,
    horse, Drosophila fly, and rat all function well in yeast that lack their
    own native yeast cytochrome c...Furthermore, extensive genetic analysis of
    cytochrome c has demonstrated that the majority of the protein sequence is
    unnecessary for its function in vivo. Only about a third of the 100 amino
    acids in cytochrome c are necessary to specify its function.<HR></BLOCKQUOTE>

    What these studies imply is that most differences we see in mammalian and
    yeast cytochrome C are not necessary for function.

    Note I said "most differences." There are different versions of cytochrome
    C which are slightly better at electron transport. But do these variations
    in cyt C correlate with an intelligent design theory, or evolution?

    <BLOCKQUOTE>quote:</font><HR>Nonetheless, for the sake of argument, let us assume that a
    cytochrome c that transports electrons faster is required in organisms with
    active metabolisms or with high rates of muscle contraction. If this were
    true, we might expect to observe a pattern of sequence similarity that
    correlates with similarity of environment or with physiological requirement.
    However, this is not observed. For example, bat cytochrome c is much more
    similar to human cytochrome c than to hummingbird cytochrome c; porpoise
    cytochrome c is much more similar to human cytochrome c than to shark
    cytochrome c. As stated earlier in prediction 3, the phylogenetic tree
    constructed from the cytochrome c data exactly recapitulates the
    relationships of major taxa as determined by the completely independent
    morphological data (McLaughlin and Dayhoff 1973). These facts only
    further support the idea that cytochrome c sequences are independent of
    phenotypic function (other than the obvious requirement for a functional
    cytochrome c that transports electrons).
    <HR></BLOCKQUOTE>

    The author's conclusions for cytochrome c:
    <BLOCKQUOTE>quote:</font><HR>The evidence given above demonstrates that for many ubiquitous
    functional proteins (such as cytochrome c), there is an enormous number of
    equivalent sequences which could form that protein in any given organism.
    Whenever we find that two organisms have the same or very similar sequences
    for a ubiquitous protein, we know that something fishy is going on. Why
    would these two organisms have such similar ubiquitous proteins when the
    odds are astronomically against it? We know of only one reason for why
    two organisms would have two similar protein sequences in the absence of
    functional necessity: heredity.
    Thus, in such cases we can confidently
    deduce that the two organisms are genealogically related. In this sense,
    sequence similarity is not only a test of the theory of common descent;
    common descent is also a deduction from the principle of heredity and the
    observation of sequence similarity. Finally, the similarity observed for
    cytochrome c is not confined to this single ubiquitous protein; all
    ubiquitous proteins that have been compared between chimpanzees and humans
    are highly similar, and there have been many comparisons.
    <HR></BLOCKQUOTE>

    Moving along to the "junk DNA" examples:

    <BLOCKQUOTE>quote:</font><HR>Transposons are very similar to viruses. However, they lack genes for
    viral coat proteins, cannot cross cellular boundaries, and thus they
    replicate only in the genome of their host. They can be thought of as
    intragenomic parasites. Except in the rarest of circumstances, the only mode
    of transmission from one metazoan organism to another is directly by DNA
    duplication and inheritance (e.g. your transposons are given to your
    children) (Li 1997, pp. 338-345).

    Finding the same transposon in the same chromosomal location in two
    different species is strong direct evidence of common ancestry, since they
    insert randomly and generally cannot be transmitted except by inheritance.
    In addition, once a common ancestor has been postulated that contains this
    transposition, all the descendants of this common ancestor should also
    contain the same transposition. A possible exception is if this
    transposition were removed due to a rare deletion event; however, deletions
    are never clean and usually part of the transposon sequence remains.

    Confirmation:
    A common class of transposon is the SINE retroelement (Li 1997, pp.
    349-352). One important SINE transposon is the 300 bp Alu element. All
    mammals contain many Alu elements, including humans where they constitute
    10% of the human genome (i.e. 60 million bases of functionless DNA) (Smit
    1996; Li 1997, pp. 354, 357). Very recent human Alu transpositions have been
    used to elucidate historic and prehistoric human migrations, since some
    individuals have newer Alu insertions that other individuals lack. Most
    importantly, in the human á-globin cluster there are seven Alu elements, and
    each one is shared with chimpanzees in the exact same seven locations
    (Sawada, Willard et al. 1985).

    More specifically, three different specific SINE transpositions have been
    found in the same chromosomal locations of cetaceans (whales), hippos, and
    ruminants, all of which are closely related according to the standard
    phylogenetic tree. However, all other mammals, including camels and pigs,
    lack these three specific transpositions (Shimamura 1997).<HR></BLOCKQUOTE>

    Here is another example, using pseudogenes:
    <BLOCKQUOTE>quote:</font><HR>Other nonfunctional molecular examples that provide evidence of
    common ancestry are pseudogenes. Pseudogenes are very closely related to
    their functional counterparts (in primary sequence and often in chromosomal
    location), except that either they have faulty regulatory sequences or they
    have internal stops that keep the protein from being made. They are
    functionless and do not affect an organism's phenotype when deleted.
    Pseudogenes, if they are not vestigial (like the examples in prediction 7),
    are created by gene duplication and subsequent mutation. There are many
    observed processes that duplicate genes, including transposition events,
    chromosomal duplication, and unequal crossing over of chromosomes. Like
    transpositions (c.f. prediction 19), gene duplication is a rare and random
    event and, of course, any duplicated DNA is inherited. Thus, finding the
    same pseudogene in the same chromosomal location in two species is strong
    evidence of common ancestry.

    There are very many examples of shared pseudogenes between primates and
    humans. One is the øç-globin gene, a hemoglobin pseudogene. It is shared
    among the primates only, in the exact chromosomal location, with the same
    mutations that render it nonfunctional (Goodman, Koop et al. 1989). Another
    example is the steroid 21-hydroxylase gene. Humans have two copies of the
    steroid 21-hydroxylase gene, a functional one and a nonfunctional
    pseudogene. Inactivation of the functional gene leads to congenital adrenal
    hyperplasia (CAH), a rare and serious genetic disease. Chimps and humans
    both share the same eight bp deletion in this pseudogene that renders it
    nonfunctional (Kawaguchi, O'hUigin et al. 1992). Note that in this case, the
    nonfunctionality of the pseudogene has been positively demonstrated.<HR></BLOCKQUOTE>

    This site contains even more evidence, but this post is already too long.
    Is there abundant evidence, from functional and non-functional DNA
    sequences, that support not only human-chimp evolution, but also the entire
    evolutionary tree? Yes, definitely.

    David stated, "Creationists allow
    a certain amount of evolution and so the observed correlations could
    give a clue as to which organisms came from a common ancestor. Along this
    line, chickens may have had teeth at one time. Degeneration
    does not contradict creationist views."


    So what is the conflict between creation and evolution then? If you agree
    that studying the evidence can "give a clue as to which organisms came from
    a common ancestor" than aren't we in agreement? Exactly how much evolution
    will creationists allow for, and how can you scientifically quantify
    this amount?

    <BLOCKQUOTE>quote:</font><HR>However, I am uncertain what it means when Oolon says that a variety
    of pseudogenes exist in many primates, but are active in other
    mammals, and the inactivating mutations are identical in all these
    primates. A typical gene has 1000 base pairs of coding DNA and
    the chimp-human difference is one or two percent (say two) and for
    other apes it is larger. This would give 20 differences in this
    gene, 10 mutations per lineage, and more for other apes. So the
    pseudogenes cannot be identical, right? So among these 20 differences,
    do we know which one inactivated the gene? Or is it just assumed that
    the one that they have in common did it? <HR></BLOCKQUOTE>

    I'm not exactly sure what you are asking here. Keep in mind that the
    differences are an average. It's not that every single gene differs
    by 20 base pairs! If there was more than one difference, you would not know
    which one inactivated the gene first. But you should expect to see more
    divergence between pseudogenes of lesser-related animals than more-related
    animals (since they are not under selective pressure anymore). Read up on
    pseudogenes from that site and see if that answers your question.

    David stated, "Another thing is that if the genes were inactivated before
    the assumed split then there should be some mutations even before the split,
    and some of these might insert stop codons or whatever and also inactivate
    the gene again."


    You can't inactivate the gene again. Once it's inactivated, it's
    inactivated (except for viruses, whose mutation and replication rates are so
    high that you often get revertence). But yes, you would expect to see more
    and more changes occuring, since there is nothing selecting against the
    pseudogene mutations.

    <BLOCKQUOTE>quote:</font><HR>Also, it is logical that primates, with their agility and
    intelligence, may not need some genes (like the one for Vitamin C). In this
    case it is an advantage to deactivate the gene because the organism need not
    expend energy making the protein. Thus when such a mutation occurs it can
    spread to the whole population. Now, of all mutations, the great majority
    will not deactivate the gene. Thus there are not many mutations altogether
    that will, probably frame shifts and some others. Among these, some may be
    much more likely to occur than others, and this pattern may be common to all
    the primates, so it is possible that the same mutation could spread in all
    the populations. <HR></BLOCKQUOTE>

    Are you saying here that the mutations are similar because they occur more
    frequently, and not because they are inherited? This is very unlikely,
    David--because they would have to occur in every single sperm and egg that
    led to a new chimp. Heredity of the mutations is a much better explanation.

    But the first part of this quote is exactly the process of evolution! You
    got it! Except--the mutation did not happen because of the 'agile
    primates,' it happened randomly. It survived non-randomly because it
    conferred a fitness advantage. I also disagree with your assessment that "a
    great majority will not deactivate the gene." Most mutations do de-activate
    genes (except for gene duplications, which are a great source of evolution).

    <BLOCKQUOTE>quote:</font><HR>There are also many dramatic cultural differences that set man apart
    from all the other primates. These must have some biological basis, even if
    we haven't discovered it yet.<HR></BLOCKQUOTE>

    Absolutely. This is why I want people to accept evolution, because I
    believe that understanding these differences will help us understand
    ourselves.

    froggie
     
  17. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    FROGGIE
    Here's a site that I thought might be helpful:
    http://www.ultranet.com/~jkimball/BiologyPages/G/GenomeSizes.html

    Genome Sizes

    This site lists several organisms, from viruses to humans, and how much DNA
    and genes they have.

    Here's an interesting tidbit from the site:
    <BLOCKQUOTE>quote:</font><HR>Even though Psilotum nudum (sometimes called the "whisk fern") is a
    far simpler plant than Arabidopsis (it has no true leaves, flowers, or
    fruit), it has 3000 times as much DNA. No one knows why, but 80% or more of
    it is repetitive DNA containing no genetic information. This is also the
    case for some amphibians, which contain 30 times as much DNA as we do but
    certainly are not 30 times as complex.

    The total amount of DNA in the haploid genome is called its C value. The
    lack of a consistent relationship between the C value and the complexity of
    an organism (e.g., amphibians vs. mammals) is called the C value
    paradox.<HR></BLOCKQUOTE>

    To me, this information supports evolution far more than it supports
    intelligent design, especially the part about "80% or more of it is
    repetetive DNA."

    froggie
     
  18. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    DAVID PLAISTED

    I don't think Froggie ever did answer my question about whether the
    pseudogenes common to humans and chimps are 100 percent identical.
    I believe that Helen posted an article about large, nonrandom
    differences between humans and chimps, and these differences
    consist of stretches of DNA with no known analogue in the human
    genome. It seems puzzling that chimp DNA should be mostly almost
    identical to human DNA but with a few places with large differences.
    But this seems almost necessary, given the large differences in
    culture and behavior. This appears to be a problem both for creation
    and evolution.

    Part of the problem with the pseudogenes is this: Suppose there are
    many identical pseudogenes between humans and chimps. Now, a typical
    gene has about 1000 base pairs of coding DNA but there are also many
    introns in the gene. Based on info from the human genome, it looked
    to me like the DNA devoted to introns was much more than that devoted
    to DNA. I think about 25 percent of the human genome consists of
    genes, so the fraction devoted to coding DNA must be tiny (correct if
    I am wrong). Suppose each gene has 25 times as much DNA altogether
    as coding DNA. In the pseudogenes all this DNA is identical. Say
    there are 10 identical pseudogenes. This would be about
    250,000 base pairs, all identical between humans and apes. What
    mutation rate would explain this? If a one percent difference
    corresponds to a divergence 6 million years ago, then in 6 million
    years one would expect 2,500 differences in these genes. But there is
    not even one, which is too small by a factor of over 2000. This means
    that the divergence time is too large by a factor of over 2000, so
    the true divergence would be 3000 years ago.

    Of course, some genes have more differences than others, but the
    point is still that if many genes are completely identical then
    this implies a _very_ recent divergence. If these genes are not
    completely identical (the pseudogenes) then it becomes difficult
    to say that the human and ape pseudogenes were inactivated by the
    same mutations.

    Dave Plaisted

    * * *

    a second email arriving shortly after the first added this:

    Froggie mentions SINE retroelements and ALU elements at the same place
    in organisms that are closely related according to evolution. Again
    what we need is a systematic study of many such elements in many
    organisms to see the degree of agreement with independently derived
    phylogenies, not just specific examples where specific elements
    agree. Perhaps other supposed evidences of common descent do not
    always agree with SINE retroelements and ALU elements. It is also
    possible that transposons are not random in their choice of insertion
    site, so that one might find similar insertions in similar organisms.
    Dave Plaisted
     
  19. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    DAVID PLAISTED

    Froggie mentions cytochrome C and its differences in different organisms.
    She questions why it should differ.
    In the first place molecular phylogenies do not always agree with each
    other or with the recognized evolutionary patterns, so this is not always
    a good argument for evolution.

    As for cytochrome C, there are a number of factors that could explain
    why it differs in different organisms. Proteins are structured to be
    very specific in most cases, which means they only interact with a
    select few others. Their structures have to agree in order for this
    to happen. Also, they have to _disagree_ with other proteins to prevent
    them sticking together or interacting in some undesirable way. This
    may constrain the cytochrome C.

    It's also interesting that in the process of two proteins docking, other
    parts of the protein may be important that are not part of the places
    they actually interact. So this is another constraint on their
    structure.

    Some genes are RNA genes and regulate other genes by the RNA directly
    interacting with messenger RNA from the other genes. This could also
    help to explain the cytochrome C sequence.

    Sometimes RNA itself can be harmful to the organism (the messenger
    RNA) which may also constrain cytochrome C and other proteins.

    The DNA also tends to be self complementary (each strand) over short
    distances, implying that it may form kinks at certain times. This might
    also constrain the cytochrome C in different organisms, since the pattern
    of self complementarity seems to vary between species.

    Dave Plaisted
     
  20. Administrator2

    Administrator2
    Expand Collapse
    Administrator
    Administrator

    Joined:
    Jun 30, 2000
    Messages:
    1,254
    Likes Received:
    0
    FROGGIE

    Hello David,
    David stated, "Froggie mentions cytochrome C and its differences in
    different organisms. She questions why it should differ. In the first place
    molecular phylogenies do not always agree with each other or with the
    recognized evolutionary patterns, so this is not always a good argument for
    evolution."


    So your rebuttal is, "Scientists sometimes disagree?" Can you be more
    specific? Please show me data about how scientists debate this particular
    phylogeny.


    David stated, "As for cytochrome C, there are a number of factors that
    could explain why it differs in different organisms. Proteins are structured
    to be very specific in most cases, which means they only interact with a
    select few others. Their structures have to agree in order for this to
    happen. Also, they have to _disagree_ with other proteins to prevent them
    sticking together or interacting in some undesirable way. This may constrain
    the cytochrome C. "


    David, the evidence for evolution here is not that cytochrome C differs,
    it's that it differs in a very specific pattern that correlates with
    evolutionary theory. Why do we see the specific differences that we do?
    Also, the studies I summarized for you would have taken into account other
    functions of Cyt C (if there are any). One of them was even in vivo! So
    no, your argument does not hold here.


    David stated, "It's also interesting that in the process of two proteins
    docking, other parts of the protein may be important that are not part of
    the places they actually interact. So this is another constraint on their
    structure."


    Huh? If this was true, it would have been noted in the in vivo studies.
    Cyt C functioned the same with large chunks taken out.


    David: Some genes are RNA genes and regulate other genes by the RNA
    directly interacting with messenger RNA from the other genes. This could
    also help to explain the cytochrome C sequence.


    No, the studies I mentioned only concern the protein sequences.


    David: Sometimes RNA itself can be harmful to the organism (the messenger
    RNA) which may also constrain cytochrome C and other proteins.


    Please provide references that state that this specific RNA is harmful.


    David: The DNA also tends to be self complementary (each strand) over
    short distances, implying that it may form kinks at certain times. This
    might also constrain the cytochrome C in different organisms, since the
    pattern of self complementarity seems to vary between species.

    Again, huh? Do you mean RNA here? DNA is double stranded. Again, do you
    have any data that suggests this might be true? I know what experiments you
    could do to test this theory. Do you?


    David: I don't think Froggie ever did answer my question about whether
    the pseudogenes common to humans and chimps are 100 percent identical.


    Well, you never answered the original question from this thread that I
    started: "I’m still waiting for the creationist explanation as to why we
    have evidence of chimpanzee chromosome ends in the middle of our
    chromosomes."

    Incidentally, I did a quick pubmed search on "pseudogenes and evolution" and
    came up with 36 pages of abstracts. So the data is there if you want to
    sift through it.

    And an article from talkorigins had this to say:
    http://www.talkorigins.org/faqs/molgen/plaisted.html
    <BLOCKQUOTE>quote:</font><HR>Your point #8 suggests that humans and chimps may share pseudogenes
    for vitamin C metabolism through independent mutations resulting from loss
    of selective pressure to preserve functional genes, or even through
    selective pressure to inactivate the genes (your point #9). I fully agree
    that this is possible; indeed the history of galactosyltransferase genes
    appears to follow a very similar scheme (as I pointed out in the box to
    section 4.1). But as I mentioned above, when scientists examine the
    mutations in a particular human gene to understand the cause of a genetic
    disease, they generally find that many different mutations that can
    inactivate a gene. Therefore, as I mentioned in section 4.1, if primates
    closely related to humans have the SAME crippling mutations in their LGGLO
    pseudogenes as we see in the human pseudogenes, this finding would support
    the evolutionary model. As I pointed out, the data on this question are not
    yet available for the LGGLO pseudogenes, but in other shared pseudogenes
    identical crippling mutations clearly favor evolution (see my section 4.2).
    <HR></BLOCKQUOTE>

    Although I suspect you have read this before, David. ;)

    I don't know if all the pseudogenes are identical. We would not expect them
    to be identical because they are pseudogenes, and the selective pressure is
    no longer acting on them. They should agree with the time we have alloted
    for evolution. I did find this abstract:
    http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1318388&dopt=Abstract

    Calculation
    of sequence divergence from the thermal stability of DNA
    heteroduplexes.
    <BLOCKQUOTE>quote:</font><HR>Measurements are reported of the thermal stability of DNA
    heteroduplexes between clones of the eta-globin pseudogene from a variety of
    primates. The known sequences of this 7.1-kb region differ from each over a
    range from 1.6% for human versus chimp to nearly 12% for human versus spider
    monkey. Thermal stability was determined by standard hydroxyapatite thermal
    elution, and the results show a precisely linear decrease in thermal
    stability with divergence.
    The slope of the regression line is 1.18%
    sequence divergence per degree centigrade reduction in thermal
    stability.<HR></BLOCKQUOTE>

    David stated, "It seems puzzling that chimp DNA should be mostly almost
    identical to human DNA but with a few places with large differences. But
    this seems almost necessary, given the large differences in culture and
    behavior. This appears to be a problem both for creation and evolution."


    It is not a problem for evolution. You already solved the conundrum in your
    own post, "this seems almost necessary, given the large differences in
    culture and behavior." Evolutionary theory would predict a large degree of
    similarity (which we find--over 98%) as well as some key differences that
    evolved to make us human. That paper that Helen quoted is exciting science.
    Now perhaps we can investigate what makes us truly "human."

    David stated, "Part of the problem with the pseudogenes is this: Suppose
    there are many identical pseudogenes between humans and chimps. Now, a
    typical gene has about 1000 base pairs of coding DNA but there are also many
    introns in the gene. Based on info from the human genome, it looked to me
    like the DNA devoted to introns was much more than that devoted to DNA. I
    think about 25 percent of the human genome consists of genes, so the
    fraction devoted to coding DNA must be tiny (correct if I am wrong). Suppose
    each gene has 25 times as much DNA altogether
    as coding DNA. In the pseudogenes all this DNA is identical. Say
    there are 10 identical pseudogenes. This would be about
    250,000 base pairs, all identical between humans and apes. What
    mutation rate would explain this? If a one percent difference
    corresponds to a divergence 6 million years ago, then in 6 million
    years one would expect 2,500 differences in these genes. But there is
    not even one, which is too small by a factor of over 2000. This means
    that the divergence time is too large by a factor of over 2000, so
    the true divergence would be 3000 years ago."


    Problems with your calculations:
    1) I don't think the amount of DNA dedicated to introns is more than that of
    exons. Please provide a source for this statement.
    2) It is much less than 25% of our genome that is dedicated to actual
    protein coding genes. Try around 2%
    3) We would expect pseudogenes to differ more between chimps and humans than
    actual protein coding genes. You seem to think pseudogenes are expected to
    be identical. Remember, as soon as they become a non-functional gene, there
    is no selective pressure to keep the gene from mutating, so it should mutate
    at random, at rates consistent with what we know about mutation rates.
    4) The length of a gene includes the introns (usually), so your estimate of
    250,000 is wrong.
    5) Where did you see that there was no differences in any of the
    pseudogenes? Please provide that data, or a link.


    David stated, "Of course, some genes have more differences than others,
    but the point is still that if many genes are completely identical then this
    implies a _very_ recent divergence. If these genes are not completely
    identical (the pseudogenes) then it becomes difficult to say that the human
    and ape pseudogenes were inactivated by the same mutations."


    Define "recent." Why is it difficult to say that they were inactivated by
    the same mutation? You can look at the sequence data, and see that they
    have the same mutation.


    David stated, "Froggie mentions SINE retroelements and ALU elements at
    the same place in organisms that are closely related according to evolution.
    Again what we need is a systematic study of many such elements in many
    organisms to see the degree of agreement with independently derived
    phylogenies, not just specific examples where specific elements agree.
    Perhaps other supposed evidences of common descent do not always agree with
    SINE retroelements and ALU elements. It is also possible that transposons
    are not random in their choice of insertion site, so that one might find
    similar insertions in similar organisms."


    Again, a search at pubmed under "SINES and evolution" yielded 169 abstracts,
    so the data is out there.
    http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11441184&dopt=Abstract

    Here's one abstract:
    <BLOCKQUOTE>quote:</font><HR>To illuminate the function and evolutionary history of both genomes,
    we sequenced mouse DNA related to human chromosome 19. Comparative sequence
    alignments yielded confirmatory evidence for hypothetical genes and
    identified exons, regulatory elements, and candidate genes that were missed
    by other predictive methods. Chromosome-wide comparisons revealed a
    difference between single-copy HSA19 genes, which are overwhelmingly
    conserved in mouse, and genes residing in tandem familial clusters, which
    differ extensively in number, coding capacity, and organization between the
    two species. Finally, we sequenced breakpoints of all 15 evolutionary
    rearrangements, providing a view of the forces that drive chromosome
    evolution in mammals.<HR></BLOCKQUOTE>

    I think that's enough for now. I'm tired, and going to sleep now!

    froggie
     

Share This Page

Loading...