Digital Life

There is an appropriate saying that was once prevelant among computer people and seems appropriate for the subject of this thread: Crap in, crap out!

 

There is an appropriate saying that was once prevelant among computer people and seems appropriate for the subject of this thread: Crap in, crap out!

 

I thank you, heavenly Father for delivering me from the tempation OldRegular so innocently supplied me.

 

Ok.

An example of an increase of information would be -

Seeing wings grow on a creature which has never had wings before. Seeing scales grow in place of fur. Seeing feathers grow in place of scales. Seeing an intestine grow in an animal that formerly didn't have one (an insect for example). Seeing an invertibrate which has never had a skeleton grow a skeleton.

These would all be examples of increased information.

Examples of things that are not an increase of information: an 8 legged creature growing only 6 legs. a winged creature growing without wings. resistence to poisons through a loss of the ability to injest or process those poisons. A 2 eyed creature growing a 3rd eye. A 6 legged creature growing 8 legs.

These all represent a loss of information or a re-arrangement of existing information.

For information to be information it must express something specific. If I have ten numbers (0-9 for example) and I change one of those numbers into a non-sensical symbol that doesn't represent a quantity, can we call that symbol a "new number"? Absolutely not. Why? For the simple reason that - to be considered a number, it must SPECIFY a quantity. If we were then to declare that our non-sensical symbol represents the number 39.843, then our non-sensical symbol could be considered a number. What changed? Did the character itself change? No. Did the code change? No. The decoder changed! We intelligently decided that the symbol meant something. In order for information to be increased in genetics, the coders and decoders (in this case our DNA) have to agree on a specified expression of a new symbol. Moreover, that expression has to agree with everything else that currently exists. You can't, for example, decide that the number 3 now means 'blue' instead of the quantity of three units... that would destroy the rest of the existing code. So to be new information, the coder and decoder have to agree, and the new code must specify something specific that wasn't there before. For example, if you have 1, ,3,4,5 and you suddenly get a specimen who displays 1,2,3,4,5 should you think this is new information? It probably isn't... it's probably just an instance where the '2' wasn't missing. Changes in hemoglobin are a good example of that. We also have to accept that God was smart enough to create some animals with 'dynamic' characters. For example A,B,x,D,E. Where x might be dynamic based on environmental conditions. We know that x has a range that falls within what we know about C, for example. An example of this might be coloration changes. It's still the same structure... it just has more or less melanin production to accommodate it's environment. However, C - while dynamic - is still C. For example brown fur or light fur. The fur didn't change to feathers... it might just be a different color of fur.

According to Shannon's information, any new symbol is new information. The less likely the symbol, the more it's information content. That's like saying "the more non-sensical characters we can insert into a book, the more informative the book will be". It's a rediculous notion. In order for the book to be more informative, it has to have more information encoded, decoded, and expressing something specific. It has to have additional sentences with structure in a language the reader will understand and it has to express ideas to the reader. Simply inserting non-sensical characters isn't going to give the reader any additional information. Additionally, inserting whole random words isn't going to give any additional information to the reader. Additionally having all the right words, but not in the right order 'might' give the reader something to think about... but still probably isn't going to give the reader more information.

Our DNA is the same way. It has coders, decoders, and takes actions based upon specific sequences that the encoders and decoders agree upon. For something to 'do' anything it has to make sense within the code and it has to be expressed in some functioning specific way. We can sometimes chop up the book and put chapters in the wrong order and still express the information we wish to express - however it may be less efficient, or it may simply give the 'gist' of the information rather than the full story.

 

While quantifiable is not a normal word in my vocabulary, let me try to address what you are saying.

In keeping with our 'book' analogy - if you had a book... and you wanted to add additional information to the book, what would be required? You would have to insert information in the form of sentences and paragraphs and in the same language as the rest of the book (encoding and decoding would have to be in agreement). Also, the information would have to contain something that was not already contained in the book before - otherwise it's not NEW information... it's the same information repeated. The information itself has to express something specific - that is the language, grammer, etc (code) has to express an idea to reader that is a new idea not already expressed by that book.

For example - if I have the following information:

The book is 150 pages
The book has a green cover
The book is paperback
The book is about kittens

This is a block of information about the book. If I added the following:

@#$%^&*(

This is not information. If I added the following:

ecdrftvgb6yu

This is not information. If I added the following:

kittens green book The about pages

This is not information. If I added the following:

The book is about kittens, has a green cover, is 150 pages, and is on paperback.

This IS information... but it is still NOT new information. It is simply a re-arranged expression of the existing information. If we added:

The book is $10

That is an example of new information. It is coded properly, and it specifies something new.

In an animal or DNA this might be something like lungs (or any of the irreducably complex structures of lungs) in a marine creature with gills (something that has never had lungs before), for example.

This is an interesting statement. You have no observational evidence that the fossil record contains these transsitional forms (ie no one was there to see it happening) - only the discreet "here is one with gills... and here is one that had evolved lungs". Yet nothing in between can ever be found. You yourself state that transsitions would be long and complex, yet this isn't at all what the fossil record represents. We see discreet creature after discreet creature with no observational evidence whatsoever that one transformed into another. We don't ever see transsisions with part of a system - it goes rapidly from one discreet fully functioning system in one animal to another animal with a completely different fully developed, functioning system. This indicates that (if one believes in evolution) evolution happens very, very fast and the transsitional creatures are very short lived - so short they don't show up in the fossil record. In this case, we should be able to observe these changes in real time currently. But we do not. We don't see additions of information (as in our book analogy). We do see corruptions, losses, and re-arranging, however. This is consistent with all the other current observations we can make (such as entropy and thermodynamics). Our current (and actual) observations fit much better with a perfect creation which has been de-evolving ever since than with an imperfect creation that has been evolving ever since. This, of course, is much more in line with scripture than the theory of evolution.

 

Take the blinders off and gaze at the following list of beneficial mutations:

http://www.talkorigins.org/indexcc/CB/CB101.html

Mutations finally rendered the genes inoperable. We see MANY instances of this.
</font>[/QUOTE]You've failed to understand that cannot be the case in your vision of the universe because mutations are, in fact, random. The random nature of mutations would force the damaged gene for making vitamin c to be different in different species if they occurred independently. Only if the damaged gene were inherited from the same ancestor would the damage come through as being the same. So why is the damaged gene for all primates the same in species after species? We've allready told you the answer - a common ancestor.

Its like a test paper turned in and you suspect the one copied the other . . . and you take duplicate mistakes as evidence that copying took place. It REALLY IS very good evidence!

I want to call all the fair minded readers to take note how he has contradicted himself in this statement. How can a scientific textbook be "full of information" and yet you say "it would not be information"?

I submit that your confusion about what is and is not information is not just a slip here but is fundamental to your misunderstanding about the possibility of evolution. I suggest you take UTE's advice and actually define information and use the word consistent with your definition before you can claim you have any kind of point to make. Because you claim information increasing is impossible, your definition needs to have a quantitative measure involved, it should make it possible to compare one set of information with another and say which is greator, for example.

Once upon a time, there were no great danes. Now there are. Was this or was this not an increase in information for the genome?

Go ahead - mate some wolves and see how many great danes pop out for you.

A fossil record that you can't prove actually means what you say it means because it was unobserved. The fossils could just as easily be extinc animals created exactly the that way.</font>[/QUOTE]I'm sorry, the ideat that we are not observing fossils is simply ludicrous!

Yes, and the real geologists tried to do that and it wouldn't work for them and they opened their minds to the alternative views that DO work. However, its nice to see you confirm that, as we already knew, you are absolutely refusing to accept any reinterpreation of what you think you already know, and that no new information has a chance with YOU.

The comment remains true in spite of your massive cut and paste that did not address the issue.

Folks, it is the nature of information to build on itself and increase. This happens to all of us all our lives. It is the reason for the rise and growth of science. It is the reason our hard drives keep filling up in our computers. It is the reason evolution works.

 

Lets say you were filling up a bathtub, and it was starting to overflow. Would I need to be able to quantify the rate of overflow to demonstrate that the overflow exists? No. I can take a common sense look at what is happening and tell you - "hey - your tub is overflowing". Determining by how much - or what ammount of water will need to be removed from the floor is the job of a professional.

Another example would be a train. I don't need to know the speed and towing capacity of a train to know if the train is coming towards me or going away from me. Again, a common sense look at the train will reveal the answer. Again, a professional - a train engineer for example - might care about those things, but they are simply not required to make general observations.

I have provided you with a definition of information. Compare what you have to that definition - if it fits it is information. If it does not fit... then it is not information.

There is absolutely zero information in either line. Why?

1. You have not specified to me what line 1 represents.
2. You have not specified to me what line 2 represents.

Until it represents something actual, it is just noise, gibberish, etc. There are characters - but there is no code... no decoder... and nothing is specified.

Until something is specified, it is not information. Moreover until there is a command to the cells to do something they have never done before, it is not new information.

Now if you said that atcgatcgctacgctcgatatcgatctagctatcgatc is the genetic code for the membrane in a cell wall, for example, that now gives this string of characters a specification. It now IS something. It is a code that can be decoded and each time means the same thing. When the DNA reads this information, it goes about the process of producing the membrane.

Now you say that mutates into atcgatccctacgctcgatatcgatctagctatcgatc. Well what does this specify or represent? What happens when this code is read by the DNA? What structure is created or performed? What action is taken? What command does the DNA recieve? What effect does it have on the function of the membrane? Is it still a membrane? If not, what are the cell walls being lined with instead?

I guess someone would have to have mapped every living organism that has ever lived to know this. Until then, it is just a guess.

How do you know all the words of the book were not already written at our creation. We have simply been loosing and re-arranging the chapters since then. To date - no one has ever come close to reading the whole book.

In keeping with our membrane analogy -

Your suggestion is like saying that our new, mutated membrane is twice as thick and strong as the old membrane. This is new information, right? Well no - for several reasons. First, you don't have any new function - it's still a membrane. The membrane had thickness and strength before, we have simply changed how much. So nothing new is specified. It is sill the same thing, specifying the same function albeit in a slightly different way. However, now it is much more difficult for the cell to absorb nutrients.

The only way for this mutated gene to be new information is if it mutates into something that IS NOT a membrane. (which, afterall is exactly what evolutionists suggest have happened billions upon billions of times). This 'membrane' has to become something else other than a membrane. However, once it transforms enough to not be a membrane, it immediately looses the levels of information it has attained. If it is not a membrane anymore it must IMMEDIATELY be something else different that meets ALL the requirements for ALL levels of information. Why? Because if it is not immediately a fully functioning and operating system with a useful purpose, it will be selected out of the genome by natural selection as a useless structure which is taking up system resources without a useful function.

Moreover all of these mutations have to take place in the reproductive cells of an organism. Even IF a creature experiences a mutation, that does NOT mean that it's offspring will have that mutation. The mutation has to take place in the reproductive cells for the mutation to be passed on. For example, a person looses their arm, are all of their children born with one arm? No. Add to this that almost always when a mutation happens in reproductive cells the offspring are born sterile.

All of this adds up to such a minute possibility of evoltion happening that it is quite literally impossible.

I am keenly aware of what you have been lead to believe. But with the same level of scientific credibility, I could do the following:

I could take a minnow, a tadpole, a frog, a lizard, and a small dog. I could kill all of these creatures, then take their skeletons and burry them at varying depths in my backyard. Then I could have a paleontologist come in and "find" my skeletons. He could then laude this find as proof of evolution and it would have precisely the same credibility and level of observational reliability as the fossil record you indicate. The only person who would know otherwise is me - because I killed and burried them.

In Genesis we see that God intentionally destroyed the world with The Flood. The geologic record is not an age record, but rather a burial record. In our case - the one who knows because He was there tells us exactly what happened. However - the world has blinded themselves to the truth, no different than if I said "hey I burried those creatures in my yard" and the paleantologist called me a whacko crackpot.

Whoa there nelly - never did we say that mutations were not beneficial. We are clear to point out that they are in the wrong direction. For example, on windy islands we see winged beetles experience mutations where they loose their wings. This is a beneficial mutation, but is directionally the wrong kind of change for microbes to man evolution. This is evendence of man to microbes evolution as information is LOST (as all the winged beetles are blown out to sea).

There are other possible explainations. For example, they could have a similar cause or reason for the malfunction. For example, lets say some pollutant gets in the water. Lets say this pollutant causes mutations in a specific gene that has receptor cells for the elements in that pollutant. The gene shuts down in all creatures exposed in the same way because the reason for the mutation was common - it attacked specific receptor cells in both man and beast.

Moreover, we know from scripture that all life do NOT have common ancestory:

1Cr 15:36 [Thou] fool, that which thou sowest is not quickened, except it die:
37 And that which thou sowest, thou sowest not that body that shall be, but bare grain, it may chance of wheat, or of some other [grain]:
38 But God giveth it a body as it hath pleased him, and to every seed his own body.
39 All flesh [is] not the same flesh: but [there is] one [kind of] flesh of men, another flesh of beasts, another of fishes, [and] another of birds.

Here we see the Word talking about seeds and sowing (reproduction) and in this context is says that all flesh is not the same flesh - or does not have the same ancestors. It re-affirms the words of Genesis 1 in that organisms reproduce after their own kind.

Now lets say the whole class has the same mistakes. Either the whole class has colluded and cheated or perhaps (more likely) the instructor taught wrong or the cirriculum they studied had the wrong answer. Again, we can look to the designer's side as a much more likely source of broad sweeping uniformity.

Moreover it is just common sense - if animals were not commonly designed, then we would not be able to eat them.

In the presence of a decoder to understand the book (aka someone who understands it) it becomes useful infomration. The same is true for our DNA. It can mutate and transform into an oblivion of different things, but unless it means something to the DNA (for example - make a membrane, or make a mitochondria) then it isn't information - it's just code.

How did great danes come to be? Unnatural sexual selection. They were bread that way. What this means is that specific qualities already resident in the genome were isolated and selected.

Are you trying to proove my point or yours? If you tried to breed great danes out of wolves and were unsuccessful, what could you say for sure? That there were no genes for great danes present in wolves. Again, this shows a greater level of diversification in the past, and a higher degree of loss and specific expression today. This is exactly THE OPPOSITE direction of what we should see if evolution is true today. We should see a multitude of animals that could be bread into other species easily as they have all this built up information from evolution. However, this isn't what we see. We see that poodles can no longer have offspring that can be bread into danes - at least not without sexual re-combination. This is precisely what we would predict using the Biblical model of kinds. Clearly, wolves and great danes are members of the dog kind. If you traced it back, you would eventually find a dog from which both great dane and wolf could be selectively bread.

Doesn't evolution assume that dinosaurs died out 60 million years before man evolved? IF that is true, then how could man have observed live dinosaurs?

Well in the abscence of a live dinosaur viewing... how about producing an eyewitness of someone who saw any live dinosaur get burried? Well in the abscence of that how about any eye witnesses to what wiped the dinosaurs out?

Well you are just coming up empty on all fronts here... I thought you had all this observational evidence!!

A nice bit of revisionist history there... but truthfully it was men like Lyell - who it has become known planned out how to remove God from all scientific endevours - who early fostered the ideas of millions of years using geology.

Act 26:14 And when we were all fallen to the earth, I heard a voice speaking unto me, and saying in the Hebrew tongue, Saul, Saul, why persecutest thou me? [it is] hard for thee to kick against the pricks.

It must be difficult for you to understand the nature of faith. I take a 6000 year old earth by faith because that is what the Bible teaches. You are absolutely correct - no ammount of evidence you show me from any secular endevour will every change my mind about that. To convince me, you have only one avenue - you must show it to me from scripture.

Hbr 11:1 Now faith is the substance of things hoped for, the evidence of things not seen.

The wealth of my evidence far exceeds that of yours because mine is based on faith - so you have no chance of convincing me using secular or humanistic means.

However, your evidence is based on faith as well - as I pointed out. Those things you have not seen (such as live dinosaurs or the events of their burial) you believe so strongly anyway though you have not seen them.

And this, according to evolution, happens by a series of losses and natural selection - a means by which information is discarded.

Evolution just doesn't add up. Evolution claims that 10-5=15. You can bearly give me an example of an information gain (all are highly debatable), yet I can give you many undesputed examples of information loss. Just look at the thousands of species which have gone extinct - including the dinosaurs.

 

I thought you guys would like this. AiG had a MegaConference this week in VA. Dr. Werner Gitt spoke, and here is the notes from that speaking:
http://info.answersingenesis.org/mc2005/


1. What is a Law of Nature?

Due to their explanatory power, and their correspondence to reality, laws of nature represent the highest level of significance in science. The following points about laws of nature are especially significant.

Laws of nature:

-Know no exceptions.
-Are unchanging in time (past, present or future).
-Can tell us whether a process being contemplated is even possible or not.
-Exist prior to, and independent of, their discovery and formulation.
-Can always be successfully applied to unknown situations.

2. What is Information?
Information is not a property of matter!

The American mathematician, Norbert Wiener, made the oft-cited statement: “Information is information, neither matter nor energy.”

What causes information to come into existence at all – what is the initiating factor? What causes us to write a letter, a postcard, a note of congratulations, a diary entry or a file note? The most important prerequisite for this is our own will, or that of the person who assigned the task to us. Information always depends upon the will of a sender, who initially creates the information.

Natural-Law Definition of Information

Information is an encoded, symbolic representation of material realities or conceptual relationships conveying expected action and intended purpose. Information is always present when, in an observable system, all of the following five hierarchical levels (or attributes) are present: statistics, syntax (code), semantics (meaning), pragmatics (action) and apobetics (purpose).

3. Laws of Nature about Information

The ten most important laws of nature about information include the following:

1. A purely material entity cannot generate a non-material entity.
2. Information is a non-material fundamental entity.
3. Information is the non-material foundation for all program-directed technological systems and all biological systems.
4. There can be no information without a code.
5. Every code is a result of a freely-willed convention.
6. There can be no new information without an intelligent, purposeful sender.
7. Any given chain of information can be traced back to an intelligent source.
8. Allocating meaning to a set of symbols by a sender, and determining meaning from a set of symbols by a recipient, are mental processes requiring intelligence.
9. Information cannot originate in statistical processes.
10. The storage and transmission of information requires a material medium.

4. Six Conclusions:
All scientific thought and practice reaches a limit beyond which science is inherently unable to take us. This situation is no exception. But our questions involve matters beyond this limiting boundary, and so to successfully transcend it, we need a higher source of information. This higher source of information is the Bible.

Conclusion #1 – God exists; refutation of atheism.
Because all forms of life contain a code (DNA, RNA), as well as all of the other levels of information, we are within the definition domain of information. We can therefore conclude that: There must be an intelligent Sender!

Conclusion #2 – There is only one God, who is all-knowing and eternal.
The information encoded in DNA far exceeds all our current technologies. Hence, no human being could possibly qualify as the Sender, who must therefore be sought outside of our visible world. We can conclude that:

There is only one Sender, who must not only be exceptionally intelligent, but must possess an infinitely large amount of information and intelligence. (i.e., He must be omniscient (all-knowing), and beyond that must also be eternal.

Conclusion #3 – God is immensely powerful
Because the Sender
• ingeniously encoded the information in the DNA molecules.
• must have constructed the complex bio-machinery which decodes the information and carries out all the processes of biosynthesis.
• was responsible for all the details of the original construction and abilities of all living things, we can conclude that:

The Sender wanted this all to be so and that: He must be immensely powerful.

Conclusion #4 – God is spirit
Because information is a non-material fundamental entity, it cannot originate from a material one. We can therefore conclude that:

The Sender must have a non-material component (spirit) to His nature.

Conclusion #5 – No human being without a soul: refutation of materialism
Because people have the ability to create information, this cannot originate from our material portion (body). We can therefore conclude that:

Each person must have a non-material component (spirit, soul).

Conclusion #6 – No evolution
Since –
• biological information, the fundamental component of all life, originates only from an intelligent sender and
• all theories of chemical and biological evolution require that information must have originated solely from matter and energy (no sender), we conclude that:

o All theories or concepts of chemical and biological evolution (macroevolution) are false.

With the help of the laws of information we can reach a comprehensive and fundamental conclusion: the idea of macroevolution – i.e., the journey from chemicals to primordial cell to man—is false. Information is a fundamental and absolutely necessary factor for all living things. But all information—and living systems are not excluded—needs a non-material source. The evolutionary system, in the light of the laws of information, shows itself to be an “intellectual perpetual motion machine.”

 

I think, Gup, you need to answer the question.

If your idea is correct, it should be easy to do.